Incidental Mutation 'R5994:Tnnt3'
ID 481004
Institutional Source Beutler Lab
Gene Symbol Tnnt3
Ensembl Gene ENSMUSG00000061723
Gene Name troponin T3, skeletal, fast
Synonyms skeletal muscle fast-twitch TnT, fTnT
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 142052573-142069746 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 142065003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 48 (K48E)
Ref Sequence ENSEMBL: ENSMUSP00000116087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074187] [ENSMUST00000078497] [ENSMUST00000105941] [ENSMUST00000105942] [ENSMUST00000105943] [ENSMUST00000105944] [ENSMUST00000105945] [ENSMUST00000105946] [ENSMUST00000105947] [ENSMUST00000105948] [ENSMUST00000105949] [ENSMUST00000105950] [ENSMUST00000105952] [ENSMUST00000105953] [ENSMUST00000105954] [ENSMUST00000105955] [ENSMUST00000105957] [ENSMUST00000105958] [ENSMUST00000128294] [ENSMUST00000146804] [ENSMUST00000169299] [ENSMUST00000179658] [ENSMUST00000180152]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054910
SMART Domains Protein: ENSMUSP00000061994
Gene: ENSMUSG00000043795

DomainStartEndE-ValueType
Pfam:DUF4643 6 259 1.3e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074187
AA Change: K51E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073815
Gene: ENSMUSG00000061723
AA Change: K51E

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078497
AA Change: K71E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077587
Gene: ENSMUSG00000061723
AA Change: K71E

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
Pfam:Troponin 72 214 2.1e-42 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105941
AA Change: K51E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101561
Gene: ENSMUSG00000061723
AA Change: K51E

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 2.1e-42 PFAM
low complexity region 229 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105942
AA Change: K42E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101562
Gene: ENSMUSG00000061723
AA Change: K42E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.7e-42 PFAM
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105943
AA Change: K42E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101563
Gene: ENSMUSG00000061723
AA Change: K42E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.9e-42 PFAM
low complexity region 220 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105944
AA Change: K53E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101564
Gene: ENSMUSG00000061723
AA Change: K53E

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2e-42 PFAM
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105945
AA Change: K51E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101565
Gene: ENSMUSG00000061723
AA Change: K51E

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105946
AA Change: K57E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101566
Gene: ENSMUSG00000061723
AA Change: K57E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105947
AA Change: K62E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101567
Gene: ENSMUSG00000061723
AA Change: K62E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.9e-42 PFAM
low complexity region 240 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105948
AA Change: K53E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101568
Gene: ENSMUSG00000061723
AA Change: K53E

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2.2e-42 PFAM
low complexity region 231 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105949
AA Change: K47E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101569
Gene: ENSMUSG00000061723
AA Change: K47E

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Troponin 48 190 1.8e-42 PFAM
low complexity region 229 241 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105950
AA Change: K65E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101570
Gene: ENSMUSG00000061723
AA Change: K65E

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
internal_repeat_1 213 240 4.67e-5 PROSPERO
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105952
AA Change: K62E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101572
Gene: ENSMUSG00000061723
AA Change: K62E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105953
AA Change: K65E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101573
Gene: ENSMUSG00000061723
AA Change: K65E

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105954
AA Change: K66E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101574
Gene: ENSMUSG00000061723
AA Change: K66E

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Troponin 67 209 1.9e-42 PFAM
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105955
AA Change: K58E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101575
Gene: ENSMUSG00000061723
AA Change: K58E

DomainStartEndE-ValueType
coiled coil region 1 36 N/A INTRINSIC
Pfam:Troponin 59 201 2.2e-42 PFAM
low complexity region 240 252 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105957
AA Change: K62E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101577
Gene: ENSMUSG00000061723
AA Change: K62E

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105958
AA Change: K75E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101578
Gene: ENSMUSG00000061723
AA Change: K75E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 2.1e-42 PFAM
low complexity region 253 269 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128294
AA Change: K48E
SMART Domains Protein: ENSMUSP00000116223
Gene: ENSMUSG00000061723
AA Change: K48E

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Troponin 49 107 3.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146804
AA Change: K48E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116087
Gene: ENSMUSG00000061723
AA Change: K48E

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Troponin 49 191 1.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169299
AA Change: K57E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127854
Gene: ENSMUSG00000061723
AA Change: K57E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179658
AA Change: K75E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136278
Gene: ENSMUSG00000061723
AA Change: K75E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 212 1.5e-36 PFAM
low complexity region 257 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144259
Predicted Effect probably damaging
Transcript: ENSMUST00000180152
AA Change: K75E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137111
Gene: ENSMUSG00000061723
AA Change: K75E

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 5.1e-42 PFAM
internal_repeat_1 223 250 2.76e-5 PROSPERO
low complexity region 257 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, liver and kidney hemorrhage and thin diaphragm. Mice heterozygous for this allele exhibit growth retardation with mild skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Tnnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Tnnt3 APN 7 142,062,062 (GRCm39) intron probably benign
IGL02376:Tnnt3 APN 7 142,066,295 (GRCm39) missense possibly damaging 0.64
R0432:Tnnt3 UTSW 7 142,065,823 (GRCm39) missense probably benign 0.09
R0463:Tnnt3 UTSW 7 142,066,072 (GRCm39) missense probably benign 0.25
R1421:Tnnt3 UTSW 7 142,065,103 (GRCm39) missense probably damaging 0.97
R1521:Tnnt3 UTSW 7 142,069,562 (GRCm39) nonsense probably null
R1789:Tnnt3 UTSW 7 142,066,101 (GRCm39) missense probably damaging 1.00
R1990:Tnnt3 UTSW 7 142,065,262 (GRCm39) missense possibly damaging 0.78
R1991:Tnnt3 UTSW 7 142,065,262 (GRCm39) missense possibly damaging 0.78
R2029:Tnnt3 UTSW 7 142,066,364 (GRCm39) splice site probably benign
R2216:Tnnt3 UTSW 7 142,066,301 (GRCm39) missense probably benign 0.03
R4779:Tnnt3 UTSW 7 142,068,020 (GRCm39) intron probably benign
R5568:Tnnt3 UTSW 7 142,065,777 (GRCm39) missense probably damaging 0.98
R5756:Tnnt3 UTSW 7 142,056,495 (GRCm39) critical splice donor site probably null
R6265:Tnnt3 UTSW 7 142,055,382 (GRCm39) missense probably damaging 0.98
R7658:Tnnt3 UTSW 7 142,065,833 (GRCm39) nonsense probably null
R8280:Tnnt3 UTSW 7 142,055,359 (GRCm39) missense unknown
R9074:Tnnt3 UTSW 7 142,065,823 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCATGATCAGCCAGGGCCTAG -3'
(R):5'- GCGAATTCTTTGCTGCTCAG -3'

Sequencing Primer
(F):5'- GCCTAGGTTCCTCCGTGAC -3'
(R):5'- TTCTCCTGCAGCCAAGAGG -3'
Posted On 2017-06-26