Incidental Mutation 'R5994:Npy5r'
ID 481006
Institutional Source Beutler Lab
Gene Symbol Npy5r
Ensembl Gene ENSMUSG00000044014
Gene Name neuropeptide Y receptor Y5
Synonyms Y5R
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 66679965-66688128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66682099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 14 (V14D)
Ref Sequence ENSEMBL: ENSMUSP00000148589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070810] [ENSMUST00000211920] [ENSMUST00000212563]
AlphaFold O70342
Predicted Effect probably benign
Transcript: ENSMUST00000070810
AA Change: V14D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065157
Gene: ENSMUSG00000044014
AA Change: V14D

DomainStartEndE-ValueType
internal_repeat_1 15 36 1.53e-7 PROSPERO
internal_repeat_1 36 57 1.53e-7 PROSPERO
Pfam:7TM_GPCR_Srsx 73 253 1.9e-10 PFAM
Pfam:7tm_1 79 445 2.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211920
AA Change: V14D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212563
AA Change: V14D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for neuropeptide Y and peptide YY. The encoded protein appears to be involved in regulating food intake, with defects in this gene being associated with eating disorders. Also, the encoded protein is involved in a pathway that protects neuroblastoma cells from chemotherapy-induced cell death, providing a possible therapeutic target against neuroblastoma. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show increased susceptibility to diet-induced obesity and a reduced orexigenic response to select agonists. Homozygotes for a reporter allele show mild late-onset obesity, increased adiposity, polyphagia, and exacerbated obesity parameters after chronic NPY infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Npy5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Npy5r APN 8 66681866 missense possibly damaging 0.47
IGL02192:Npy5r APN 8 66681346 missense probably benign 0.02
oleo UTSW 8 66682041 nonsense probably null
roly-poly UTSW 8 66681540 frame shift probably null
R0395:Npy5r UTSW 8 66681973 missense probably benign 0.21
R1547:Npy5r UTSW 8 66681034 missense possibly damaging 0.52
R1616:Npy5r UTSW 8 66681400 missense probably damaging 1.00
R1906:Npy5r UTSW 8 66681473 missense probably damaging 1.00
R1965:Npy5r UTSW 8 66681277 missense probably benign
R2443:Npy5r UTSW 8 66681290 nonsense probably null
R4087:Npy5r UTSW 8 66682045 missense probably damaging 0.98
R4204:Npy5r UTSW 8 66682041 nonsense probably null
R4404:Npy5r UTSW 8 66681992 missense probably benign 0.01
R5427:Npy5r UTSW 8 66681020 missense probably damaging 0.98
R5530:Npy5r UTSW 8 66680860 missense probably benign 0.06
R6041:Npy5r UTSW 8 66682023 missense possibly damaging 0.72
R6602:Npy5r UTSW 8 66681540 frame shift probably null
R6837:Npy5r UTSW 8 66681740 missense probably benign 0.00
R7879:Npy5r UTSW 8 66681316 missense possibly damaging 0.92
R7923:Npy5r UTSW 8 66681752 missense probably damaging 1.00
R8534:Npy5r UTSW 8 66682036 missense probably benign 0.00
R8699:Npy5r UTSW 8 66681622 missense probably damaging 1.00
R9094:Npy5r UTSW 8 66680908 missense probably damaging 1.00
R9338:Npy5r UTSW 8 66682006 missense probably benign 0.00
R9436:Npy5r UTSW 8 66680831 missense probably damaging 1.00
R9501:Npy5r UTSW 8 66681485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAGTCTTCTGATTGCGC -3'
(R):5'- CTGGCCCTTTGTGATCCTAGAG -3'

Sequencing Primer
(F):5'- GATTGCGCTTTTTCATAACAGC -3'
(R):5'- TGATCCTAGAGGTTTGTAAGAGAATG -3'
Posted On 2017-06-26