Incidental Mutation 'R5994:Psd3'
ID 481007
Institutional Source Beutler Lab
Gene Symbol Psd3
Ensembl Gene ENSMUSG00000030465
Gene Name pleckstrin and Sec7 domain containing 3
Synonyms EFA6D, 4931420C21Rik
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 68141734-68664679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68172620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 894 (A894T)
Ref Sequence ENSEMBL: ENSMUSP00000148401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038959] [ENSMUST00000059374] [ENSMUST00000093468] [ENSMUST00000093469] [ENSMUST00000098696] [ENSMUST00000120071] [ENSMUST00000212505] [ENSMUST00000212960]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038959
AA Change: A864T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041339
Gene: ENSMUSG00000030465
AA Change: A864T

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 693 3.9e-53 SMART
PH 743 857 3.85e-15 SMART
Blast:Sec7 876 938 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000059374
AA Change: A235T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060306
Gene: ENSMUSG00000030465
AA Change: A235T

DomainStartEndE-ValueType
PH 114 228 3.85e-15 SMART
Blast:Sec7 247 305 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093468
AA Change: A377T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091178
Gene: ENSMUSG00000030465
AA Change: A377T

DomainStartEndE-ValueType
Sec7 17 206 1.35e-56 SMART
PH 256 370 3.85e-15 SMART
Blast:Sec7 389 451 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093469
AA Change: A863T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091179
Gene: ENSMUSG00000030465
AA Change: A863T

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098696
AA Change: A863T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096293
Gene: ENSMUSG00000030465
AA Change: A863T

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120071
AA Change: A235T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112545
Gene: ENSMUSG00000030465
AA Change: A235T

DomainStartEndE-ValueType
PH 114 228 3.85e-15 SMART
Blast:Sec7 247 309 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000212505
AA Change: A894T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212960
AA Change: A1148T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Psd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Psd3 APN 8 68,361,331 (GRCm39) splice site probably benign
IGL01095:Psd3 APN 8 68,361,165 (GRCm39) missense probably damaging 1.00
IGL01139:Psd3 APN 8 68,361,187 (GRCm39) missense probably damaging 1.00
IGL01330:Psd3 APN 8 68,149,830 (GRCm39) missense probably damaging 1.00
IGL01350:Psd3 APN 8 68,173,544 (GRCm39) missense probably damaging 1.00
IGL01487:Psd3 APN 8 68,149,766 (GRCm39) missense probably benign 0.01
IGL01780:Psd3 APN 8 68,416,521 (GRCm39) missense probably benign
IGL02020:Psd3 APN 8 68,426,822 (GRCm39) intron probably benign
IGL02232:Psd3 APN 8 68,356,797 (GRCm39) missense probably damaging 1.00
IGL02350:Psd3 APN 8 68,416,521 (GRCm39) missense probably benign
IGL02357:Psd3 APN 8 68,416,521 (GRCm39) missense probably benign
PIT4495001:Psd3 UTSW 8 68,416,565 (GRCm39) missense probably benign 0.00
R0052:Psd3 UTSW 8 68,335,631 (GRCm39) critical splice donor site probably null
R0052:Psd3 UTSW 8 68,335,631 (GRCm39) critical splice donor site probably null
R0242:Psd3 UTSW 8 68,210,738 (GRCm39) missense probably damaging 0.99
R0242:Psd3 UTSW 8 68,210,738 (GRCm39) missense probably damaging 0.99
R0581:Psd3 UTSW 8 68,173,598 (GRCm39) missense probably damaging 1.00
R0655:Psd3 UTSW 8 68,416,341 (GRCm39) missense probably benign 0.19
R1740:Psd3 UTSW 8 68,573,491 (GRCm39) missense probably damaging 1.00
R1789:Psd3 UTSW 8 68,413,217 (GRCm39) missense probably benign 0.26
R1847:Psd3 UTSW 8 68,172,656 (GRCm39) missense possibly damaging 0.93
R1951:Psd3 UTSW 8 68,416,139 (GRCm39) missense probably benign 0.00
R1954:Psd3 UTSW 8 68,149,727 (GRCm39) missense probably damaging 1.00
R2143:Psd3 UTSW 8 68,417,003 (GRCm39) missense probably damaging 1.00
R4387:Psd3 UTSW 8 68,453,413 (GRCm39) missense probably damaging 1.00
R4801:Psd3 UTSW 8 68,573,800 (GRCm39) missense probably benign
R4802:Psd3 UTSW 8 68,573,800 (GRCm39) missense probably benign
R4913:Psd3 UTSW 8 68,573,821 (GRCm39) missense probably damaging 0.99
R5045:Psd3 UTSW 8 68,166,477 (GRCm39) missense probably damaging 0.99
R5173:Psd3 UTSW 8 68,149,641 (GRCm39) missense probably damaging 1.00
R5264:Psd3 UTSW 8 68,166,377 (GRCm39) missense probably benign 0.23
R5350:Psd3 UTSW 8 68,361,513 (GRCm39) missense probably benign 0.00
R5816:Psd3 UTSW 8 68,413,162 (GRCm39) missense possibly damaging 0.90
R6157:Psd3 UTSW 8 68,574,179 (GRCm39) start codon destroyed probably benign 0.14
R6241:Psd3 UTSW 8 68,270,791 (GRCm39) intron probably benign
R6586:Psd3 UTSW 8 68,416,197 (GRCm39) missense probably damaging 0.96
R6735:Psd3 UTSW 8 68,573,398 (GRCm39) critical splice donor site probably null
R6908:Psd3 UTSW 8 68,416,829 (GRCm39) missense probably benign 0.00
R6984:Psd3 UTSW 8 68,270,697 (GRCm39) missense possibly damaging 0.85
R7082:Psd3 UTSW 8 68,356,800 (GRCm39) missense probably benign 0.03
R7116:Psd3 UTSW 8 68,166,390 (GRCm39) missense probably benign 0.12
R7297:Psd3 UTSW 8 68,573,686 (GRCm39) missense probably damaging 0.98
R7334:Psd3 UTSW 8 68,361,357 (GRCm39) missense possibly damaging 0.94
R7348:Psd3 UTSW 8 68,243,583 (GRCm39) missense possibly damaging 0.65
R7357:Psd3 UTSW 8 68,574,149 (GRCm39) missense probably benign 0.01
R7369:Psd3 UTSW 8 68,356,818 (GRCm39) missense possibly damaging 0.95
R7385:Psd3 UTSW 8 68,453,408 (GRCm39) missense probably damaging 1.00
R7733:Psd3 UTSW 8 68,573,568 (GRCm39) missense possibly damaging 0.75
R7873:Psd3 UTSW 8 68,335,634 (GRCm39) missense possibly damaging 0.95
R8110:Psd3 UTSW 8 68,573,708 (GRCm39) missense probably damaging 1.00
R8765:Psd3 UTSW 8 68,416,093 (GRCm39) missense possibly damaging 0.69
R8768:Psd3 UTSW 8 68,417,003 (GRCm39) missense probably damaging 1.00
R8817:Psd3 UTSW 8 68,413,135 (GRCm39) missense possibly damaging 0.95
R8837:Psd3 UTSW 8 68,172,596 (GRCm39) missense probably damaging 0.99
R8878:Psd3 UTSW 8 68,210,750 (GRCm39) missense probably benign 0.28
R8903:Psd3 UTSW 8 68,165,945 (GRCm39) missense unknown
R8955:Psd3 UTSW 8 68,416,461 (GRCm39) missense probably benign 0.08
R9216:Psd3 UTSW 8 68,573,539 (GRCm39) missense probably benign 0.00
R9241:Psd3 UTSW 8 68,415,967 (GRCm39) missense probably benign 0.00
R9351:Psd3 UTSW 8 68,413,301 (GRCm39) missense probably benign 0.18
R9449:Psd3 UTSW 8 68,165,833 (GRCm39) missense unknown
R9451:Psd3 UTSW 8 68,363,487 (GRCm39) missense unknown
R9709:Psd3 UTSW 8 68,194,414 (GRCm39) missense probably null 0.99
R9797:Psd3 UTSW 8 68,210,778 (GRCm39) missense probably damaging 0.99
Z1088:Psd3 UTSW 8 68,358,912 (GRCm39) splice site silent
Predicted Primers PCR Primer
(F):5'- CCTGCAATTCACTACTGCAAGG -3'
(R):5'- ACCAGTGAAGTTTTGCACTAAG -3'

Sequencing Primer
(F):5'- GCAATTCACTACTGCAAGGTTTATC -3'
(R):5'- CCAGTGAAGTTTTGCACTAAGAATAC -3'
Posted On 2017-06-26