Incidental Mutation 'R5994:Psd3'
ID481007
Institutional Source Beutler Lab
Gene Symbol Psd3
Ensembl Gene ENSMUSG00000030465
Gene Namepleckstrin and Sec7 domain containing 3
SynonymsEFA6D, 4931420C21Rik
MMRRC Submission 044173-MU
Accession Numbers

Ncbi RefSeq: NM_030263.5, NM_027626.1; MGI:1918215

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location67689082-68212027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67719968 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 894 (A894T)
Ref Sequence ENSEMBL: ENSMUSP00000148401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038959] [ENSMUST00000059374] [ENSMUST00000093468] [ENSMUST00000093469] [ENSMUST00000098696] [ENSMUST00000120071] [ENSMUST00000212505] [ENSMUST00000212960]
Predicted Effect probably damaging
Transcript: ENSMUST00000038959
AA Change: A864T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041339
Gene: ENSMUSG00000030465
AA Change: A864T

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 693 3.9e-53 SMART
PH 743 857 3.85e-15 SMART
Blast:Sec7 876 938 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000059374
AA Change: A235T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060306
Gene: ENSMUSG00000030465
AA Change: A235T

DomainStartEndE-ValueType
PH 114 228 3.85e-15 SMART
Blast:Sec7 247 305 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093468
AA Change: A377T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091178
Gene: ENSMUSG00000030465
AA Change: A377T

DomainStartEndE-ValueType
Sec7 17 206 1.35e-56 SMART
PH 256 370 3.85e-15 SMART
Blast:Sec7 389 451 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093469
AA Change: A863T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091179
Gene: ENSMUSG00000030465
AA Change: A863T

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098696
AA Change: A863T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096293
Gene: ENSMUSG00000030465
AA Change: A863T

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120071
AA Change: A235T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112545
Gene: ENSMUSG00000030465
AA Change: A235T

DomainStartEndE-ValueType
PH 114 228 3.85e-15 SMART
Blast:Sec7 247 309 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000212505
AA Change: A894T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212960
AA Change: A1148T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Psd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Psd3 APN 8 67908679 splice site probably benign
IGL01095:Psd3 APN 8 67908513 missense probably damaging 1.00
IGL01139:Psd3 APN 8 67908535 missense probably damaging 1.00
IGL01330:Psd3 APN 8 67697178 missense probably damaging 1.00
IGL01350:Psd3 APN 8 67720892 missense probably damaging 1.00
IGL01487:Psd3 APN 8 67697114 missense probably benign 0.01
IGL01780:Psd3 APN 8 67963869 missense probably benign
IGL02020:Psd3 APN 8 67974170 intron probably benign
IGL02232:Psd3 APN 8 67904145 missense probably damaging 1.00
IGL02350:Psd3 APN 8 67963869 missense probably benign
IGL02357:Psd3 APN 8 67963869 missense probably benign
PIT4495001:Psd3 UTSW 8 67963913 missense probably benign 0.00
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0581:Psd3 UTSW 8 67720946 missense probably damaging 1.00
R0655:Psd3 UTSW 8 67963689 missense probably benign 0.19
R1740:Psd3 UTSW 8 68120839 missense probably damaging 1.00
R1789:Psd3 UTSW 8 67960565 missense probably benign 0.26
R1847:Psd3 UTSW 8 67720004 missense possibly damaging 0.93
R1951:Psd3 UTSW 8 67963487 missense probably benign 0.00
R1954:Psd3 UTSW 8 67697075 missense probably damaging 1.00
R2143:Psd3 UTSW 8 67964351 missense probably damaging 1.00
R4387:Psd3 UTSW 8 68000761 missense probably damaging 1.00
R4801:Psd3 UTSW 8 68121148 missense probably benign
R4802:Psd3 UTSW 8 68121148 missense probably benign
R4913:Psd3 UTSW 8 68121169 missense probably damaging 0.99
R5045:Psd3 UTSW 8 67713825 missense probably damaging 0.99
R5173:Psd3 UTSW 8 67696989 missense probably damaging 1.00
R5264:Psd3 UTSW 8 67713725 missense probably benign 0.23
R5350:Psd3 UTSW 8 67908861 missense probably benign 0.00
R5816:Psd3 UTSW 8 67960510 missense possibly damaging 0.90
R6157:Psd3 UTSW 8 68121527 start codon destroyed probably benign 0.14
R6241:Psd3 UTSW 8 67818139 intron probably benign
R6586:Psd3 UTSW 8 67963545 missense probably damaging 0.96
R6735:Psd3 UTSW 8 68120746 critical splice donor site probably null
R6908:Psd3 UTSW 8 67964177 missense probably benign 0.00
R6984:Psd3 UTSW 8 67818045 missense possibly damaging 0.85
R7082:Psd3 UTSW 8 67904148 missense probably benign 0.03
R7116:Psd3 UTSW 8 67713738 missense probably benign 0.12
R7297:Psd3 UTSW 8 68121034 missense probably damaging 0.98
R7334:Psd3 UTSW 8 67908705 missense possibly damaging 0.94
R7348:Psd3 UTSW 8 67790931 missense possibly damaging 0.65
R7357:Psd3 UTSW 8 68121497 missense probably benign 0.01
R7369:Psd3 UTSW 8 67904166 missense possibly damaging 0.95
R7385:Psd3 UTSW 8 68000756 missense probably damaging 1.00
R7733:Psd3 UTSW 8 68120916 missense possibly damaging 0.75
R7873:Psd3 UTSW 8 67882982 missense possibly damaging 0.95
R8110:Psd3 UTSW 8 68121056 missense probably damaging 1.00
R8765:Psd3 UTSW 8 67963441 missense possibly damaging 0.69
R8768:Psd3 UTSW 8 67964351 missense probably damaging 1.00
R8817:Psd3 UTSW 8 67960483 missense possibly damaging 0.95
R8837:Psd3 UTSW 8 67719944 missense probably damaging 0.99
R8878:Psd3 UTSW 8 67758098 missense probably benign 0.28
R8903:Psd3 UTSW 8 67713293 missense unknown
R8955:Psd3 UTSW 8 67963809 missense probably benign 0.08
Z1088:Psd3 UTSW 8 67906260 splice site silent
Predicted Primers PCR Primer
(F):5'- CCTGCAATTCACTACTGCAAGG -3'
(R):5'- ACCAGTGAAGTTTTGCACTAAG -3'

Sequencing Primer
(F):5'- GCAATTCACTACTGCAAGGTTTATC -3'
(R):5'- CCAGTGAAGTTTTGCACTAAGAATAC -3'
Posted On2017-06-26