Incidental Mutation 'R5994:Ano8'
ID481008
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Nameanoctamin 8
SynonymsTmem16h
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5994 (G1)
Quality Score98.0078
Status Not validated
Chromosome8
Chromosomal Location71476019-71485963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71484834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 89 (V89M)
Ref Sequence ENSEMBL: ENSMUSP00000149365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
Predicted Effect probably benign
Transcript: ENSMUST00000007754
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093450
AA Change: V89M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863
AA Change: V89M

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124349
Predicted Effect probably benign
Transcript: ENSMUST00000127741
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146551
Predicted Effect probably benign
Transcript: ENSMUST00000150969
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect probably damaging
Transcript: ENSMUST00000213382
AA Change: V89M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71484258 splice site probably benign
IGL00501:Ano8 APN 8 71479149 critical splice donor site probably null
IGL01380:Ano8 APN 8 71480809 unclassified probably benign
IGL02138:Ano8 APN 8 71484842 missense probably damaging 0.99
IGL02516:Ano8 APN 8 71485077 missense probably damaging 1.00
IGL02675:Ano8 APN 8 71483540 missense probably damaging 0.99
IGL02995:Ano8 APN 8 71483117 missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71478744 unclassified probably benign
R0265:Ano8 UTSW 8 71480524 unclassified probably benign
R0282:Ano8 UTSW 8 71480614 unclassified probably benign
R0518:Ano8 UTSW 8 71479258 missense probably benign 0.39
R0521:Ano8 UTSW 8 71479258 missense probably benign 0.39
R1028:Ano8 UTSW 8 71480971 small deletion probably benign
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1748:Ano8 UTSW 8 71478958 unclassified probably benign
R1852:Ano8 UTSW 8 71483487 missense probably damaging 0.99
R4161:Ano8 UTSW 8 71482637 missense probably damaging 1.00
R4192:Ano8 UTSW 8 71483292 missense probably damaging 1.00
R4274:Ano8 UTSW 8 71478741 unclassified probably benign
R4834:Ano8 UTSW 8 71484295 missense probably damaging 1.00
R4961:Ano8 UTSW 8 71482996 missense probably damaging 1.00
R5252:Ano8 UTSW 8 71482617 missense probably damaging 1.00
R5553:Ano8 UTSW 8 71484997 splice site probably null
R5598:Ano8 UTSW 8 71482577 missense probably damaging 1.00
R5695:Ano8 UTSW 8 71483243 missense probably damaging 0.98
R6019:Ano8 UTSW 8 71482380 missense probably damaging 1.00
R6153:Ano8 UTSW 8 71480797 unclassified probably benign
R6405:Ano8 UTSW 8 71483030 missense probably damaging 1.00
R6516:Ano8 UTSW 8 71481780 splice site probably null
R6539:Ano8 UTSW 8 71484483 missense probably damaging 1.00
R7194:Ano8 UTSW 8 71482363 missense possibly damaging 0.66
R7204:Ano8 UTSW 8 71479025 missense probably benign 0.39
R7340:Ano8 UTSW 8 71483011 missense probably damaging 0.99
R7365:Ano8 UTSW 8 71485110 missense probably damaging 1.00
R7417:Ano8 UTSW 8 71480833 missense unknown
R7486:Ano8 UTSW 8 71484998 critical splice donor site probably null
R7644:Ano8 UTSW 8 71484830 missense probably damaging 0.98
R7709:Ano8 UTSW 8 71482289 missense probably damaging 1.00
R7719:Ano8 UTSW 8 71483140 missense possibly damaging 0.82
R8040:Ano8 UTSW 8 71482168 missense probably benign 0.26
R8219:Ano8 UTSW 8 71480713 missense unknown
R8401:Ano8 UTSW 8 71483367 missense probably damaging 1.00
X0026:Ano8 UTSW 8 71479157 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAAACGAATAGTTAGCACAGTTGG -3'
(R):5'- TCCCACAAGGCATGGATGAAG -3'

Sequencing Primer
(F):5'- AGCACAGTTGGTCTTCAGAG -3'
(R):5'- ACTGCGACGTGCTCATGAC -3'
Posted On2017-06-26