Incidental Mutation 'R5994:Ano8'
ID 481008
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Name anoctamin 8
Synonyms Tmem16h
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5994 (G1)
Quality Score 98.0078
Status Not validated
Chromosome 8
Chromosomal Location 71928663-71938607 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71937478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 89 (V89M)
Ref Sequence ENSEMBL: ENSMUSP00000149365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
AlphaFold Q6PB70
Predicted Effect probably benign
Transcript: ENSMUST00000007754
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093450
AA Change: V89M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863
AA Change: V89M

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124349
Predicted Effect probably benign
Transcript: ENSMUST00000127741
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146551
Predicted Effect probably benign
Transcript: ENSMUST00000150969
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect probably damaging
Transcript: ENSMUST00000213382
AA Change: V89M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71,936,902 (GRCm39) splice site probably benign
IGL00501:Ano8 APN 8 71,931,793 (GRCm39) critical splice donor site probably null
IGL01380:Ano8 APN 8 71,933,453 (GRCm39) unclassified probably benign
IGL02138:Ano8 APN 8 71,937,486 (GRCm39) missense probably damaging 0.99
IGL02516:Ano8 APN 8 71,937,721 (GRCm39) missense probably damaging 1.00
IGL02675:Ano8 APN 8 71,936,184 (GRCm39) missense probably damaging 0.99
IGL02995:Ano8 APN 8 71,935,761 (GRCm39) missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71,931,388 (GRCm39) unclassified probably benign
R0265:Ano8 UTSW 8 71,933,168 (GRCm39) unclassified probably benign
R0282:Ano8 UTSW 8 71,933,258 (GRCm39) unclassified probably benign
R0518:Ano8 UTSW 8 71,931,902 (GRCm39) missense probably benign 0.39
R0521:Ano8 UTSW 8 71,931,902 (GRCm39) missense probably benign 0.39
R1028:Ano8 UTSW 8 71,933,615 (GRCm39) small deletion probably benign
R1147:Ano8 UTSW 8 71,934,661 (GRCm39) missense probably damaging 1.00
R1147:Ano8 UTSW 8 71,934,661 (GRCm39) missense probably damaging 1.00
R1748:Ano8 UTSW 8 71,931,602 (GRCm39) unclassified probably benign
R1852:Ano8 UTSW 8 71,936,131 (GRCm39) missense probably damaging 0.99
R4161:Ano8 UTSW 8 71,935,281 (GRCm39) missense probably damaging 1.00
R4192:Ano8 UTSW 8 71,935,936 (GRCm39) missense probably damaging 1.00
R4274:Ano8 UTSW 8 71,931,385 (GRCm39) unclassified probably benign
R4834:Ano8 UTSW 8 71,936,939 (GRCm39) missense probably damaging 1.00
R4961:Ano8 UTSW 8 71,935,640 (GRCm39) missense probably damaging 1.00
R5252:Ano8 UTSW 8 71,935,261 (GRCm39) missense probably damaging 1.00
R5553:Ano8 UTSW 8 71,937,641 (GRCm39) splice site probably null
R5598:Ano8 UTSW 8 71,935,221 (GRCm39) missense probably damaging 1.00
R5695:Ano8 UTSW 8 71,935,887 (GRCm39) missense probably damaging 0.98
R6019:Ano8 UTSW 8 71,935,024 (GRCm39) missense probably damaging 1.00
R6153:Ano8 UTSW 8 71,933,441 (GRCm39) unclassified probably benign
R6405:Ano8 UTSW 8 71,935,674 (GRCm39) missense probably damaging 1.00
R6516:Ano8 UTSW 8 71,934,424 (GRCm39) splice site probably null
R6539:Ano8 UTSW 8 71,937,127 (GRCm39) missense probably damaging 1.00
R7194:Ano8 UTSW 8 71,935,007 (GRCm39) missense possibly damaging 0.66
R7204:Ano8 UTSW 8 71,931,669 (GRCm39) missense probably benign 0.39
R7340:Ano8 UTSW 8 71,935,655 (GRCm39) missense probably damaging 0.99
R7365:Ano8 UTSW 8 71,937,754 (GRCm39) missense probably damaging 1.00
R7417:Ano8 UTSW 8 71,933,477 (GRCm39) missense unknown
R7486:Ano8 UTSW 8 71,937,642 (GRCm39) critical splice donor site probably null
R7644:Ano8 UTSW 8 71,937,474 (GRCm39) missense probably damaging 0.98
R7709:Ano8 UTSW 8 71,934,933 (GRCm39) missense probably damaging 1.00
R7719:Ano8 UTSW 8 71,935,784 (GRCm39) missense possibly damaging 0.82
R8040:Ano8 UTSW 8 71,934,812 (GRCm39) missense probably benign 0.26
R8219:Ano8 UTSW 8 71,933,357 (GRCm39) missense unknown
R8355:Ano8 UTSW 8 71,933,210 (GRCm39) unclassified probably benign
R8401:Ano8 UTSW 8 71,936,011 (GRCm39) missense probably damaging 1.00
R8713:Ano8 UTSW 8 71,937,721 (GRCm39) missense probably damaging 1.00
R8755:Ano8 UTSW 8 71,935,724 (GRCm39) missense probably benign 0.11
R8871:Ano8 UTSW 8 71,931,944 (GRCm39) missense probably benign 0.39
R8903:Ano8 UTSW 8 71,934,834 (GRCm39) critical splice acceptor site probably null
R8990:Ano8 UTSW 8 71,929,201 (GRCm39) missense unknown
R9037:Ano8 UTSW 8 71,937,088 (GRCm39) missense probably damaging 1.00
R9379:Ano8 UTSW 8 71,936,178 (GRCm39) missense probably benign 0.28
R9432:Ano8 UTSW 8 71,933,561 (GRCm39) missense unknown
R9492:Ano8 UTSW 8 71,934,784 (GRCm39) missense possibly damaging 0.66
R9609:Ano8 UTSW 8 71,933,726 (GRCm39) missense unknown
X0026:Ano8 UTSW 8 71,931,801 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAAACGAATAGTTAGCACAGTTGG -3'
(R):5'- TCCCACAAGGCATGGATGAAG -3'

Sequencing Primer
(F):5'- AGCACAGTTGGTCTTCAGAG -3'
(R):5'- ACTGCGACGTGCTCATGAC -3'
Posted On 2017-06-26