Mutagenetix > Incidental Mutation

Incidental Mutation 'R5994:Ucp1'

481009

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

MMRRC Submission

044173-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5994 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84016981-84025081 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 84020567 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 126 (V126L)

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146]

AlphaFold

P12242

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034146
AA Change: V126L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: V126L

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,647,862 (GRCm39)	H1118L	probably benign	Het
Abca8b	A	G	11: 109,840,592 (GRCm39)		probably null	Het
Abcb5	A	T	12: 118,928,995 (GRCm39)		probably null	Het
Adcy6	A	T	15: 98,491,545 (GRCm39)	I1016N	probably damaging	Het
Afg3l2	A	T	18: 67,562,140 (GRCm39)	C312S	probably damaging	Het
Ano8	C	T	8: 71,937,478 (GRCm39)	V89M	probably damaging	Het
Arhgap21	C	T	2: 20,886,187 (GRCm39)	G330D	possibly damaging	Het
Caskin1	T	C	17: 24,715,935 (GRCm39)	L195P	probably damaging	Het
Cfap54	A	G	10: 92,874,943 (GRCm39)	I514T	probably damaging	Het
Ctdsp2	G	A	10: 126,831,689 (GRCm39)		probably benign	Het
Cyp4x1	T	C	4: 114,979,142 (GRCm39)	I152V	probably benign	Het
Dglucy	G	A	12: 100,808,959 (GRCm39)	R219Q	probably benign	Het
Disp3	G	T	4: 148,338,741 (GRCm39)	A810E	possibly damaging	Het
Dtx4	T	C	19: 12,478,517 (GRCm39)	Y22C	probably damaging	Het
Edaradd	A	T	13: 12,493,377 (GRCm39)	I105N	probably damaging	Het
Eepd1	C	T	9: 25,514,749 (GRCm39)	P519S	probably damaging	Het
Fscn3	A	T	6: 28,430,294 (GRCm39)	S155C	probably benign	Het
Gm10134	A	T	2: 28,396,258 (GRCm39)	E51V	probably damaging	Het
Gm7247	C	T	14: 51,601,805 (GRCm39)	S26F	probably benign	Het
Golga7	T	C	8: 23,740,281 (GRCm39)	E83G	probably benign	Het
Gpr12	T	C	5: 146,520,241 (GRCm39)	H227R	probably damaging	Het
Hoxa2	T	G	6: 52,141,372 (GRCm39)	S85R	possibly damaging	Het
Hrnr	T	C	3: 93,239,607 (GRCm39)	S3282P	unknown	Het
Ift74	C	A	4: 94,579,961 (GRCm39)	T543K	possibly damaging	Het
Klf10	C	A	15: 38,296,285 (GRCm39)	R420L	probably damaging	Het
Krt77	T	A	15: 101,771,290 (GRCm39)	I338F	probably damaging	Het
Limch1	A	T	5: 67,131,965 (GRCm39)	S152C	probably damaging	Het
Mgat4e	T	A	1: 134,469,234 (GRCm39)	H270L	probably benign	Het
Myrf	A	T	19: 10,196,481 (GRCm39)	L504Q	probably null	Het
Nckipsd	A	G	9: 108,691,176 (GRCm39)	Q366R	probably benign	Het
Npy5r	A	T	8: 67,134,751 (GRCm39)	V14D	probably benign	Het
Nrap	T	A	19: 56,340,031 (GRCm39)	R830*	probably null	Het
Ogfrl1	A	T	1: 23,418,070 (GRCm39)	Y103N	probably damaging	Het
Or10g7	A	T	9: 39,905,519 (GRCm39)	R138*	probably null	Het
P2rx4	T	A	5: 122,863,142 (GRCm39)	L232H	probably damaging	Het
Pabpc2	A	T	18: 39,906,947 (GRCm39)	T71S	probably benign	Het
Paip2b	C	A	6: 83,785,867 (GRCm39)	S121I	probably damaging	Het
Pofut1	C	T	2: 153,103,149 (GRCm39)	T261I	possibly damaging	Het
Ppp6c	G	T	2: 39,101,004 (GRCm39)	T46K	possibly damaging	Het
Prkd2	C	A	7: 16,584,261 (GRCm39)	H371Q	probably benign	Het
Prrc2c	A	T	1: 162,501,725 (GRCm39)		probably null	Het
Psd3	C	T	8: 68,172,620 (GRCm39)	A894T	probably damaging	Het
Pygm	A	T	19: 6,448,073 (GRCm39)		probably null	Het
Pzp	A	T	6: 128,468,560 (GRCm39)	M989K	probably damaging	Het
Ralgapa2	A	T	2: 146,203,373 (GRCm39)	S1159T	probably benign	Het
Rapgefl1	T	C	11: 98,740,986 (GRCm39)	F575L	probably benign	Het
Rassf6	A	G	5: 90,765,627 (GRCm39)	L28S	probably damaging	Het
Rbp3	G	T	14: 33,676,857 (GRCm39)	K268N	probably damaging	Het
Rela	C	T	19: 5,697,092 (GRCm39)	T433M	possibly damaging	Het
Rnf103	T	A	6: 71,473,894 (GRCm39)	S102R	probably damaging	Het
Scarf2	A	G	16: 17,624,243 (GRCm39)	N516S	probably damaging	Het
Sdcbp2	T	C	2: 151,429,403 (GRCm39)	I241T	probably damaging	Het
Septin7	T	C	9: 25,199,494 (GRCm39)	I131T	possibly damaging	Het
Sh3pxd2b	T	C	11: 32,357,570 (GRCm39)	F191L	probably damaging	Het
Siglec15	C	A	18: 78,090,590 (GRCm39)	C236F	probably damaging	Het
Slc11a2	T	C	15: 100,295,562 (GRCm39)	T520A	probably benign	Het
Slc26a11	C	A	11: 119,270,738 (GRCm39)	F553L	probably benign	Het
Smchd1	G	A	17: 71,672,404 (GRCm39)	P1596S	possibly damaging	Het
Taar7b	A	G	10: 23,876,246 (GRCm39)	H137R	probably damaging	Het
Thap12	T	A	7: 98,365,237 (GRCm39)	C468*	probably null	Het
Timp4	C	T	6: 115,224,315 (GRCm39)	G118D	probably damaging	Het
Tnnt3	A	G	7: 142,065,003 (GRCm39)	K48E	probably damaging	Het
Trmt10a	T	A	3: 137,862,475 (GRCm39)	I255N	probably damaging	Het
Ttll10	T	C	4: 156,133,189 (GRCm39)		probably null	Het
Tut7	T	G	13: 59,937,023 (GRCm39)	Y806S	probably damaging	Het
Ube4b	A	G	4: 149,457,389 (GRCm39)	Y283H	probably damaging	Het
Unc13b	T	A	4: 43,172,596 (GRCm39)		probably benign	Het
Vps13b	T	C	15: 35,875,918 (GRCm39)	S2768P	probably damaging	Het
Zfp101	T	A	17: 33,599,936 (GRCm39)	M607L	probably benign	Het
Zfp292	C	T	4: 34,805,464 (GRCm39)	V2527M	possibly damaging	Het
Zfp503	T	A	14: 22,035,630 (GRCm39)	T429S	possibly damaging	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4585001:Ucp1	UTSW	8	84,020,577 (GRCm39)	missense	probably damaging	1.00
R0050:Ucp1	UTSW	8	84,020,857 (GRCm39)	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0505:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	84,018,232 (GRCm39)	splice site	probably benign
R0681:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	84,024,476 (GRCm39)	splice site	probably benign
R1606:Ucp1	UTSW	8	84,021,933 (GRCm39)	missense	probably damaging	1.00
R1722:Ucp1	UTSW	8	84,017,317 (GRCm39)	missense	probably benign	0.25
R1809:Ucp1	UTSW	8	84,024,496 (GRCm39)	missense	probably damaging	0.99
R1823:Ucp1	UTSW	8	84,020,661 (GRCm39)	missense	probably damaging	1.00
R3809:Ucp1	UTSW	8	84,017,270 (GRCm39)	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	84,020,580 (GRCm39)	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	84,021,876 (GRCm39)	missense	probably damaging	1.00
R4998:Ucp1	UTSW	8	84,024,484 (GRCm39)	critical splice acceptor site	probably null
R5163:Ucp1	UTSW	8	84,020,832 (GRCm39)	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	84,017,320 (GRCm39)	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	84,024,520 (GRCm39)	missense	possibly damaging	0.54
R6574:Ucp1	UTSW	8	84,020,718 (GRCm39)	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	84,018,106 (GRCm39)	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	84,020,531 (GRCm39)	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	84,021,881 (GRCm39)	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	84,024,521 (GRCm39)	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	84,020,640 (GRCm39)	missense	probably benign	0.32
R8365:Ucp1	UTSW	8	84,020,628 (GRCm39)	missense	probably damaging	0.97
R8899:Ucp1	UTSW	8	84,017,216 (GRCm39)	missense	probably benign	0.35
R9186:Ucp1	UTSW	8	84,017,272 (GRCm39)	nonsense	probably null
R9499:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9551:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9552:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTTTGTCCTCTGTGCAC -3'
(R):5'- TGTTCACTTGGCAGTTAGCTACC -3'

Sequencing Primer
(F):5'- GTCCTCTGTGCACCCACTAC -3'
(R):5'- GGCAGTTAGCTACCTTTCCAAAGTG -3'

Posted On

2017-06-26