Incidental Mutation 'R5994:Septin7'
ID 481010
Institutional Source Beutler Lab
Gene Symbol Septin7
Ensembl Gene ENSMUSG00000001833
Gene Name septin 7
Synonyms Cdc10, Sept7
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 25163735-25219867 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25199494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 131 (I131T)
Ref Sequence ENSEMBL: ENSMUSP00000110927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115272] [ENSMUST00000165594]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115272
AA Change: I131T

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110927
Gene: ENSMUSG00000001833
AA Change: I131T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.7e-126 PFAM
Pfam:MMR_HSR1 52 252 2.5e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165594
AA Change: I131T

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127641
Gene: ENSMUSG00000001833
AA Change: I131T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.6e-126 PFAM
Pfam:MMR_HSR1 52 197 4.9e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217598
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibit reduced axon and dendrite length and complexity. Mice homozygous for a knock-out allele die prior to E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Septin7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Septin7 APN 9 25,207,786 (GRCm39) splice site probably benign
R0331:Septin7 UTSW 9 25,217,552 (GRCm39) missense probably benign 0.00
R1590:Septin7 UTSW 9 25,188,900 (GRCm39) missense probably damaging 0.99
R2040:Septin7 UTSW 9 25,199,532 (GRCm39) missense possibly damaging 0.79
R4935:Septin7 UTSW 9 25,217,468 (GRCm39) missense probably benign 0.03
R5246:Septin7 UTSW 9 25,210,832 (GRCm39) missense probably damaging 1.00
R5426:Septin7 UTSW 9 25,197,986 (GRCm39) missense possibly damaging 0.92
R5629:Septin7 UTSW 9 25,199,589 (GRCm39) missense probably damaging 1.00
R6177:Septin7 UTSW 9 25,205,100 (GRCm39) critical splice donor site probably null
R6246:Septin7 UTSW 9 25,218,817 (GRCm39) missense probably benign 0.00
R6735:Septin7 UTSW 9 25,215,048 (GRCm39) missense possibly damaging 0.94
R7561:Septin7 UTSW 9 25,209,151 (GRCm39) missense possibly damaging 0.77
R7837:Septin7 UTSW 9 25,199,531 (GRCm39) missense possibly damaging 0.92
R8442:Septin7 UTSW 9 25,163,938 (GRCm39) missense unknown
R8852:Septin7 UTSW 9 25,163,980 (GRCm39) missense possibly damaging 0.68
R8860:Septin7 UTSW 9 25,163,980 (GRCm39) missense possibly damaging 0.68
R9070:Septin7 UTSW 9 25,175,507 (GRCm39) splice site probably benign
R9138:Septin7 UTSW 9 25,212,761 (GRCm39) missense probably damaging 1.00
X0066:Septin7 UTSW 9 25,217,436 (GRCm39) missense possibly damaging 0.88
Z1176:Septin7 UTSW 9 25,163,852 (GRCm39) start gained probably benign
Z1177:Septin7 UTSW 9 25,212,719 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTTGAGCCATCTCCCCAATC -3'
(R):5'- TAGTTCCGTGTACTCCACAGAC -3'

Sequencing Primer
(F):5'- GCCATCTCCCCAATCCTAATTTTTAC -3'
(R):5'- GTGTACTCCACAGACACCATTATTC -3'
Posted On 2017-06-26