Incidental Mutation 'R5994:Taar7b'
ID481014
Institutional Source Beutler Lab
Gene Symbol Taar7b
Ensembl Gene ENSMUSG00000095171
Gene Nametrace amine-associated receptor 7B
SynonymsLOC209517
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23999939-24001015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24000348 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 137 (H137R)
Ref Sequence ENSEMBL: ENSMUSP00000090328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092658]
Predicted Effect probably damaging
Transcript: ENSMUST00000092658
AA Change: H137R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090328
Gene: ENSMUSG00000095171
AA Change: H137R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 261 1.9e-7 PFAM
Pfam:7tm_1 64 326 7.3e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Taar7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Taar7b APN 10 24000842 missense probably benign 0.01
IGL00771:Taar7b APN 10 24000198 missense probably benign 0.01
IGL01662:Taar7b APN 10 23999976 missense probably benign 0.02
IGL02186:Taar7b APN 10 23999981 missense probably benign 0.00
IGL02399:Taar7b APN 10 24000152 missense probably damaging 0.99
IGL02514:Taar7b APN 10 24000984 missense probably benign 0.00
IGL02601:Taar7b APN 10 24000306 missense probably damaging 1.00
IGL02717:Taar7b APN 10 24000360 missense probably damaging 1.00
IGL02724:Taar7b APN 10 24000683 missense probably benign
IGL02725:Taar7b APN 10 24000063 missense probably benign 0.03
R0103:Taar7b UTSW 10 24000294 missense probably benign 0.00
R2060:Taar7b UTSW 10 24000675 missense possibly damaging 0.95
R4973:Taar7b UTSW 10 24000345 missense probably benign 0.08
R5055:Taar7b UTSW 10 24000947 missense possibly damaging 0.75
R5068:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5069:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5070:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5205:Taar7b UTSW 10 24000018 missense probably benign 0.05
R6131:Taar7b UTSW 10 24000717 missense probably benign 0.20
R6302:Taar7b UTSW 10 24000260 missense possibly damaging 0.57
R6332:Taar7b UTSW 10 23999951 missense probably benign 0.05
R6809:Taar7b UTSW 10 24000858 missense probably benign 0.03
R7126:Taar7b UTSW 10 24000062 missense possibly damaging 0.93
R7520:Taar7b UTSW 10 24000483 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCAGGCAGCTACACTCC -3'
(R):5'- ACTGCAAGTTGACAGCCAC -3'

Sequencing Primer
(F):5'- GCAGCTACACTCCCCTGC -3'
(R):5'- GAGGGCACTCACTAGATCCTC -3'
Posted On2017-06-26