Incidental Mutation 'R5994:Rbp3'
ID 481025
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Name retinol binding protein 3, interstitial
Synonyms Irbp, Rbp-3
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 33675960-33686173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33676857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 268 (K268N)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: K268N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: K268N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33,676,145 (GRCm39) missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33,678,793 (GRCm39) missense probably benign 0.18
IGL01665:Rbp3 APN 14 33,678,088 (GRCm39) missense probably benign 0.02
IGL01809:Rbp3 APN 14 33,677,257 (GRCm39) missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33,680,602 (GRCm39) missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33,677,676 (GRCm39) missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33,676,460 (GRCm39) missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33,680,540 (GRCm39) missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33,676,616 (GRCm39) missense probably damaging 0.97
Behagt UTSW 14 33,676,411 (GRCm39) missense probably benign 0.00
jagt UTSW 14 33,678,439 (GRCm39) missense probably damaging 0.97
muntre UTSW 14 33,678,313 (GRCm39) missense possibly damaging 0.95
Rotwild UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33,677,456 (GRCm39) missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33,677,858 (GRCm39) missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33,677,858 (GRCm39) missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33,676,730 (GRCm39) missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33,684,376 (GRCm39) missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33,680,605 (GRCm39) missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33,680,604 (GRCm39) missense probably benign 0.28
R0747:Rbp3 UTSW 14 33,678,235 (GRCm39) missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33,678,595 (GRCm39) missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33,678,313 (GRCm39) missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33,676,481 (GRCm39) missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33,677,749 (GRCm39) missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33,678,155 (GRCm39) missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33,678,866 (GRCm39) missense probably benign 0.38
R1830:Rbp3 UTSW 14 33,676,601 (GRCm39) missense probably benign 0.31
R1982:Rbp3 UTSW 14 33,676,502 (GRCm39) missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33,678,418 (GRCm39) missense probably benign 0.00
R1985:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2007:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33,678,014 (GRCm39) missense probably benign 0.00
R2138:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33,684,520 (GRCm39) missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33,676,411 (GRCm39) missense probably benign 0.00
R3111:Rbp3 UTSW 14 33,676,069 (GRCm39) missense probably benign 0.01
R3155:Rbp3 UTSW 14 33,679,071 (GRCm39) missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33,679,071 (GRCm39) missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33,677,969 (GRCm39) missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33,677,969 (GRCm39) missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33,677,464 (GRCm39) missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33,677,347 (GRCm39) missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4277:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4278:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4382:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4383:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4385:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4625:Rbp3 UTSW 14 33,678,056 (GRCm39) missense probably benign
R4712:Rbp3 UTSW 14 33,682,615 (GRCm39) missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33,676,731 (GRCm39) missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33,677,368 (GRCm39) missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33,676,427 (GRCm39) missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33,676,807 (GRCm39) missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33,678,370 (GRCm39) missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33,678,584 (GRCm39) missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33,676,230 (GRCm39) missense probably benign 0.00
R6010:Rbp3 UTSW 14 33,676,604 (GRCm39) missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33,678,439 (GRCm39) missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33,676,418 (GRCm39) missense probably benign
R6357:Rbp3 UTSW 14 33,678,991 (GRCm39) missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33,677,224 (GRCm39) nonsense probably null
R6777:Rbp3 UTSW 14 33,676,230 (GRCm39) missense probably benign 0.00
R7158:Rbp3 UTSW 14 33,677,513 (GRCm39) missense probably benign 0.00
R7183:Rbp3 UTSW 14 33,677,161 (GRCm39) missense probably benign 0.02
R7256:Rbp3 UTSW 14 33,684,540 (GRCm39) missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33,677,797 (GRCm39) missense probably benign
R7756:Rbp3 UTSW 14 33,676,732 (GRCm39) missense probably benign 0.15
R7758:Rbp3 UTSW 14 33,676,732 (GRCm39) missense probably benign 0.15
R7784:Rbp3 UTSW 14 33,676,115 (GRCm39) missense probably benign 0.41
R7845:Rbp3 UTSW 14 33,678,421 (GRCm39) missense probably benign 0.24
R8176:Rbp3 UTSW 14 33,677,605 (GRCm39) missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33,678,320 (GRCm39) missense probably benign 0.00
R8393:Rbp3 UTSW 14 33,678,156 (GRCm39) missense possibly damaging 0.93
R8552:Rbp3 UTSW 14 33,677,621 (GRCm39) missense probably benign 0.01
R8717:Rbp3 UTSW 14 33,678,395 (GRCm39) missense probably damaging 0.99
R8730:Rbp3 UTSW 14 33,677,795 (GRCm39) missense probably benign
R8773:Rbp3 UTSW 14 33,684,492 (GRCm39) missense possibly damaging 0.71
R8836:Rbp3 UTSW 14 33,680,588 (GRCm39) missense possibly damaging 0.95
R8843:Rbp3 UTSW 14 33,676,522 (GRCm39) missense probably benign
R8880:Rbp3 UTSW 14 33,678,796 (GRCm39) missense probably benign 0.16
R8941:Rbp3 UTSW 14 33,678,486 (GRCm39) missense possibly damaging 0.92
R8971:Rbp3 UTSW 14 33,677,792 (GRCm39) missense probably damaging 1.00
R8998:Rbp3 UTSW 14 33,684,360 (GRCm39) nonsense probably null
R8999:Rbp3 UTSW 14 33,684,360 (GRCm39) nonsense probably null
R9436:Rbp3 UTSW 14 33,677,234 (GRCm39) missense possibly damaging 0.94
R9525:Rbp3 UTSW 14 33,676,402 (GRCm39) missense probably benign 0.00
R9563:Rbp3 UTSW 14 33,677,477 (GRCm39) missense probably damaging 1.00
R9564:Rbp3 UTSW 14 33,677,477 (GRCm39) missense probably damaging 1.00
R9723:Rbp3 UTSW 14 33,677,474 (GRCm39) missense possibly damaging 0.92
Z1177:Rbp3 UTSW 14 33,676,495 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TACTTGCACCCTGGGAACAC -3'
(R):5'- TCCTGAAGTCGGAGGACAAC -3'

Sequencing Primer
(F):5'- AACACGGTCATGCACGTG -3'
(R):5'- AAGTCGGAGGACAACCCCTG -3'
Posted On 2017-06-26