Incidental Mutation 'R5994:Klf10'
ID481028
Institutional Source Beutler Lab
Gene Symbol Klf10
Ensembl Gene ENSMUSG00000037465
Gene NameKruppel-like factor 10
SynonymsTieg1, mGIF, Egral, Gdnfif
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location38291463-38300706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38296041 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 420 (R420L)
Ref Sequence ENSEMBL: ENSMUSP00000154702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074043] [ENSMUST00000226363] [ENSMUST00000227920] [ENSMUST00000228416] [ENSMUST00000228732] [ENSMUST00000228772]
Predicted Effect probably damaging
Transcript: ENSMUST00000074043
AA Change: R435L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073690
Gene: ENSMUSG00000037465
AA Change: R435L

DomainStartEndE-ValueType
low complexity region 134 149 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
low complexity region 316 336 N/A INTRINSIC
ZnF_C2H2 368 392 1.56e-2 SMART
ZnF_C2H2 398 422 5.99e-4 SMART
ZnF_C2H2 428 450 3.63e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226363
AA Change: R420L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000227920
Predicted Effect probably benign
Transcript: ENSMUST00000228416
Predicted Effect probably benign
Transcript: ENSMUST00000228732
Predicted Effect probably benign
Transcript: ENSMUST00000228772
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that feature C2H2-type zinc finger domains. The encoded protein is a transcriptional repressor that acts as an effector of transforming growth factor beta signaling. Activity of this protein may inhibit the growth of cancers, particularly pancreatic cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants display increased osteoblast formation and impaired osteoblast function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Klf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Klf10 APN 15 38297284 missense probably benign 0.35
IGL02168:Klf10 APN 15 38296841 missense probably damaging 1.00
IGL02444:Klf10 APN 15 38297824 missense probably damaging 1.00
R0360:Klf10 UTSW 15 38296846 missense probably benign
R1544:Klf10 UTSW 15 38296786 missense probably damaging 1.00
R1961:Klf10 UTSW 15 38295996 missense probably damaging 0.99
R2301:Klf10 UTSW 15 38297082 missense possibly damaging 0.83
R2517:Klf10 UTSW 15 38297113 missense probably benign 0.26
R5217:Klf10 UTSW 15 38296087 missense probably damaging 1.00
R5498:Klf10 UTSW 15 38296039 missense probably damaging 1.00
R6086:Klf10 UTSW 15 38296937 missense probably benign 0.02
R7386:Klf10 UTSW 15 38296949 missense possibly damaging 0.68
R7474:Klf10 UTSW 15 38297202 missense probably benign 0.05
R7579:Klf10 UTSW 15 38297038 missense probably benign 0.02
R7617:Klf10 UTSW 15 38296836 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTCCTGACTCTGACCAAAG -3'
(R):5'- CTGTGGACACAAATGCAAGG -3'

Sequencing Primer
(F):5'- GACTCTGACCAAAGTTTATTCTGCG -3'
(R):5'- GTAGACCAGGCTGATCTTGAACTC -3'
Posted On2017-06-26