Incidental Mutation 'R5994:Slc11a2'
ID 481030
Institutional Source Beutler Lab
Gene Symbol Slc11a2
Ensembl Gene ENSMUSG00000023030
Gene Name solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Synonyms DMT1, van, DCT1, Nramp2, microcytic anemia, viable anaemia
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 100387898-100425072 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100397681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 520 (T520A)
Ref Sequence ENSEMBL: ENSMUSP00000116463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023774] [ENSMUST00000124324] [ENSMUST00000138843]
AlphaFold P49282
Predicted Effect probably benign
Transcript: ENSMUST00000023774
AA Change: T520A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023774
Gene: ENSMUSG00000023030
AA Change: T520A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 474 1.1e-122 PFAM
transmembrane domain 505 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124324
AA Change: T211A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114702
Gene: ENSMUSG00000023030
AA Change: T211A

DomainStartEndE-ValueType
Pfam:Nramp 1 165 1.4e-39 PFAM
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138843
AA Change: T520A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116463
Gene: ENSMUSG00000023030
AA Change: T520A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 474 4.7e-118 PFAM
transmembrane domain 505 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140535
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 11 protein family. The product of this gene transports divalent metals and is involved in iron absorption. Mutations in this gene are associated with hypochromic microcytic anemia with iron overload. A related solute carrier family 11 protein gene is located on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit microcytic, hypochromic anemia associated with impaired intestinal iron absorption and erythroblast iron uptake. Mutants have reduced viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Slc11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Slc11a2 APN 15 100397737 missense probably benign
IGL00923:Slc11a2 APN 15 100397788 missense probably benign 0.13
IGL01645:Slc11a2 APN 15 100389118 missense probably benign 0.05
IGL02146:Slc11a2 APN 15 100401288 missense probably damaging 1.00
IGL02397:Slc11a2 APN 15 100401649 missense probably damaging 1.00
IGL02534:Slc11a2 APN 15 100401326 missense probably benign 0.03
IGL02678:Slc11a2 APN 15 100412200 missense possibly damaging 0.71
R0537:Slc11a2 UTSW 15 100405798 missense probably damaging 1.00
R0538:Slc11a2 UTSW 15 100408216 missense probably damaging 1.00
R1305:Slc11a2 UTSW 15 100410082 critical splice donor site probably null
R1750:Slc11a2 UTSW 15 100401287 missense probably damaging 1.00
R1752:Slc11a2 UTSW 15 100405806 missense probably damaging 1.00
R1895:Slc11a2 UTSW 15 100403894 missense probably benign 0.10
R2278:Slc11a2 UTSW 15 100410081 critical splice donor site probably null
R2519:Slc11a2 UTSW 15 100401323 missense probably damaging 1.00
R4724:Slc11a2 UTSW 15 100406338 missense possibly damaging 0.65
R5643:Slc11a2 UTSW 15 100403187 missense probably benign
R5667:Slc11a2 UTSW 15 100403288 missense probably damaging 1.00
R5671:Slc11a2 UTSW 15 100403288 missense probably damaging 1.00
R7008:Slc11a2 UTSW 15 100409324 missense probably damaging 1.00
R7208:Slc11a2 UTSW 15 100402332 missense probably benign 0.00
R7547:Slc11a2 UTSW 15 100397770 missense possibly damaging 0.83
R7829:Slc11a2 UTSW 15 100409261 missense possibly damaging 0.95
R9015:Slc11a2 UTSW 15 100403305 missense probably benign 0.12
R9362:Slc11a2 UTSW 15 100406355 missense probably damaging 1.00
R9573:Slc11a2 UTSW 15 100406344 missense probably damaging 1.00
Z1188:Slc11a2 UTSW 15 100408099 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCGGCATTGTATAAGCCTTATG -3'
(R):5'- ACAACAGGCACTTACCGTG -3'

Sequencing Primer
(F):5'- AAGCCTTATGTTTAATCTCCAGTACC -3'
(R):5'- ACCGTGCTCTTTGTTTTGCAGAG -3'
Posted On 2017-06-26