Incidental Mutation 'R5994:Scarf2'
ID481032
Institutional Source Beutler Lab
Gene Symbol Scarf2
Ensembl Gene ENSMUSG00000012017
Gene Namescavenger receptor class F, member 2
SynonymsSrec2, SREC-II
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17797282-17808293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17806379 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 516 (N516S)
Ref Sequence ENSEMBL: ENSMUSP00000156358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012161] [ENSMUST00000232577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012161
AA Change: N516S

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000012161
Gene: ENSMUSG00000012017
AA Change: N516S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 71 102 4.56e0 SMART
EGF 113 145 2.43e1 SMART
EGF 147 174 2.03e1 SMART
EGF_like 207 233 1.68e0 SMART
EGF 235 262 1.73e1 SMART
EGF_like 309 352 2.86e1 SMART
EGF_like 323 364 4.97e0 SMART
EGF_like 367 407 8.13e-1 SMART
low complexity region 437 459 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 597 606 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
low complexity region 636 656 N/A INTRINSIC
low complexity region 665 685 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231383
Predicted Effect probably damaging
Transcript: ENSMUST00000232577
AA Change: N516S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to SCARF1/SREC-I, a scavenger receptor protein that mediates the binding and degradation of acetylated low density lipoprotein (Ac-LDL). This protein has only little activity of internalizing modified low density lipoproteins (LDL), but it can interact with SCARF1 through its extracellular domain. The association of this protein with SCARF1 is suppressed by the presence of scavenger ligands. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Scarf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Scarf2 APN 16 17802549 missense probably damaging 1.00
IGL02166:Scarf2 APN 16 17803756 missense probably damaging 0.99
IGL02604:Scarf2 APN 16 17803744 missense probably damaging 0.97
IGL03155:Scarf2 APN 16 17807549 missense probably benign 0.00
R0639:Scarf2 UTSW 16 17806505 splice site probably null
R1703:Scarf2 UTSW 16 17802849 missense probably damaging 0.99
R2182:Scarf2 UTSW 16 17803022 missense probably damaging 1.00
R4730:Scarf2 UTSW 16 17803013 missense probably damaging 0.99
R4744:Scarf2 UTSW 16 17803516 missense probably damaging 0.99
R4798:Scarf2 UTSW 16 17803507 missense probably damaging 1.00
R5521:Scarf2 UTSW 16 17803602 critical splice donor site probably null
R6742:Scarf2 UTSW 16 17806487 missense probably damaging 1.00
R7264:Scarf2 UTSW 16 17803290 missense possibly damaging 0.63
R7286:Scarf2 UTSW 16 17802973 nonsense probably null
R7385:Scarf2 UTSW 16 17803838 missense probably damaging 1.00
R7409:Scarf2 UTSW 16 17807054 missense probably damaging 0.99
R7812:Scarf2 UTSW 16 17803828 missense probably damaging 1.00
R8442:Scarf2 UTSW 16 17806367 missense probably benign 0.43
R8803:Scarf2 UTSW 16 17802831 missense probably damaging 0.98
R8865:Scarf2 UTSW 16 17803110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGAATGTCATGTCCCC -3'
(R):5'- CTGTGGCCAACAAATCCTAGTTC -3'

Sequencing Primer
(F):5'- CGTGTCATGACCACTTTG -3'
(R):5'- TCCAACATAGATAGCAAGGGCATTTC -3'
Posted On2017-06-26