Incidental Mutation 'R5994:Caskin1'
ID 481033
Institutional Source Beutler Lab
Gene Symbol Caskin1
Ensembl Gene ENSMUSG00000033597
Gene Name CASK interacting protein 1
Synonyms 3300002N10Rik, C630036E02Rik
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R5994 (G1)
Quality Score 215.009
Status Not validated
Chromosome 17
Chromosomal Location 24707575-24727645 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24715935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 195 (L195P)
Ref Sequence ENSEMBL: ENSMUSP00000024958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958]
AlphaFold Q6P9K8
Predicted Effect probably damaging
Transcript: ENSMUST00000024958
AA Change: L195P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: L195P

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Caskin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Caskin1 APN 17 24,722,863 (GRCm39) missense probably damaging 1.00
IGL00846:Caskin1 APN 17 24,718,323 (GRCm39) critical splice donor site probably null
IGL01120:Caskin1 APN 17 24,724,343 (GRCm39) missense possibly damaging 0.56
IGL01543:Caskin1 APN 17 24,723,522 (GRCm39) missense probably benign
IGL01622:Caskin1 APN 17 24,722,914 (GRCm39) critical splice donor site probably null
IGL01623:Caskin1 APN 17 24,722,914 (GRCm39) critical splice donor site probably null
IGL02120:Caskin1 APN 17 24,719,916 (GRCm39) missense probably damaging 1.00
IGL02816:Caskin1 APN 17 24,721,144 (GRCm39) missense probably benign 0.06
IGL02898:Caskin1 APN 17 24,721,383 (GRCm39) missense probably benign 0.00
IGL03353:Caskin1 APN 17 24,718,331 (GRCm39) splice site probably benign
PIT4151001:Caskin1 UTSW 17 24,721,193 (GRCm39) missense probably damaging 1.00
PIT4453001:Caskin1 UTSW 17 24,718,266 (GRCm39) missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24,723,870 (GRCm39) missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24,723,870 (GRCm39) missense probably damaging 1.00
R0190:Caskin1 UTSW 17 24,723,596 (GRCm39) missense possibly damaging 0.92
R0443:Caskin1 UTSW 17 24,724,374 (GRCm39) missense probably damaging 0.96
R0885:Caskin1 UTSW 17 24,724,668 (GRCm39) missense probably damaging 1.00
R1035:Caskin1 UTSW 17 24,724,011 (GRCm39) missense probably damaging 1.00
R1253:Caskin1 UTSW 17 24,724,047 (GRCm39) missense probably damaging 1.00
R1497:Caskin1 UTSW 17 24,723,515 (GRCm39) nonsense probably null
R1589:Caskin1 UTSW 17 24,724,452 (GRCm39) splice site probably null
R1651:Caskin1 UTSW 17 24,721,186 (GRCm39) missense possibly damaging 0.82
R1944:Caskin1 UTSW 17 24,719,745 (GRCm39) missense probably damaging 0.99
R1969:Caskin1 UTSW 17 24,725,824 (GRCm39) missense possibly damaging 0.94
R2057:Caskin1 UTSW 17 24,715,433 (GRCm39) missense probably damaging 0.99
R2127:Caskin1 UTSW 17 24,715,970 (GRCm39) critical splice donor site probably null
R2158:Caskin1 UTSW 17 24,724,128 (GRCm39) missense probably benign
R2402:Caskin1 UTSW 17 24,722,782 (GRCm39) missense probably damaging 1.00
R2895:Caskin1 UTSW 17 24,708,016 (GRCm39) missense probably damaging 1.00
R3423:Caskin1 UTSW 17 24,718,539 (GRCm39) missense probably damaging 0.98
R3800:Caskin1 UTSW 17 24,720,246 (GRCm39) missense probably benign
R4108:Caskin1 UTSW 17 24,721,121 (GRCm39) missense probably benign
R4419:Caskin1 UTSW 17 24,723,683 (GRCm39) missense probably damaging 1.00
R4510:Caskin1 UTSW 17 24,725,602 (GRCm39) missense probably benign 0.11
R4511:Caskin1 UTSW 17 24,725,602 (GRCm39) missense probably benign 0.11
R4552:Caskin1 UTSW 17 24,725,602 (GRCm39) missense probably benign 0.11
R4638:Caskin1 UTSW 17 24,725,602 (GRCm39) missense probably benign 0.11
R4642:Caskin1 UTSW 17 24,725,602 (GRCm39) missense probably benign 0.11
R4644:Caskin1 UTSW 17 24,725,602 (GRCm39) missense probably benign 0.11
R4824:Caskin1 UTSW 17 24,720,103 (GRCm39) missense probably benign 0.01
R4882:Caskin1 UTSW 17 24,723,389 (GRCm39) missense probably damaging 1.00
R4964:Caskin1 UTSW 17 24,726,135 (GRCm39) missense probably damaging 1.00
R4966:Caskin1 UTSW 17 24,726,135 (GRCm39) missense probably damaging 1.00
R5809:Caskin1 UTSW 17 24,723,521 (GRCm39) missense probably benign 0.06
R5841:Caskin1 UTSW 17 24,715,183 (GRCm39) missense probably damaging 0.99
R5877:Caskin1 UTSW 17 24,724,239 (GRCm39) missense possibly damaging 0.69
R5960:Caskin1 UTSW 17 24,717,869 (GRCm39) missense probably benign 0.31
R6022:Caskin1 UTSW 17 24,715,709 (GRCm39) missense probably benign 0.37
R6209:Caskin1 UTSW 17 24,726,095 (GRCm39) missense possibly damaging 0.84
R6228:Caskin1 UTSW 17 24,726,154 (GRCm39) missense probably damaging 0.99
R6287:Caskin1 UTSW 17 24,715,683 (GRCm39) missense probably damaging 1.00
R6497:Caskin1 UTSW 17 24,723,522 (GRCm39) missense probably benign
R6873:Caskin1 UTSW 17 24,723,153 (GRCm39) missense probably benign 0.31
R7079:Caskin1 UTSW 17 24,717,858 (GRCm39) missense probably benign 0.31
R7156:Caskin1 UTSW 17 24,719,657 (GRCm39) splice site probably null
R7385:Caskin1 UTSW 17 24,722,898 (GRCm39) missense probably damaging 1.00
R7953:Caskin1 UTSW 17 24,723,195 (GRCm39) missense probably damaging 1.00
R7993:Caskin1 UTSW 17 24,718,279 (GRCm39) nonsense probably null
R8410:Caskin1 UTSW 17 24,721,123 (GRCm39) missense possibly damaging 0.90
R8511:Caskin1 UTSW 17 24,724,910 (GRCm39) missense probably benign 0.12
R8749:Caskin1 UTSW 17 24,723,774 (GRCm39) missense probably benign 0.00
R8881:Caskin1 UTSW 17 24,718,273 (GRCm39) missense probably damaging 1.00
R8979:Caskin1 UTSW 17 24,717,899 (GRCm39) missense possibly damaging 0.51
R9005:Caskin1 UTSW 17 24,718,111 (GRCm39) missense probably benign 0.00
R9341:Caskin1 UTSW 17 24,723,447 (GRCm39) missense probably damaging 1.00
R9343:Caskin1 UTSW 17 24,723,447 (GRCm39) missense probably damaging 1.00
X0022:Caskin1 UTSW 17 24,724,140 (GRCm39) missense probably benign 0.34
X0063:Caskin1 UTSW 17 24,726,156 (GRCm39) missense probably damaging 1.00
Z1176:Caskin1 UTSW 17 24,724,012 (GRCm39) missense probably damaging 1.00
Z1177:Caskin1 UTSW 17 24,715,661 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCTATCCTTTTCACCTGGGG -3'
(R):5'- GTGCTCTTAATTGCTGAACCC -3'

Sequencing Primer
(F):5'- ACCTGGGGTGGGGCTAG -3'
(R):5'- TTAGGGTCTCACATAGCCCAAGTG -3'
Posted On 2017-06-26