Mutagenetix > Incidental Mutation

Incidental Mutation 'R5994:Caskin1'

481033

Institutional Source

Beutler Lab

Gene Symbol

Caskin1

Ensembl Gene

ENSMUSG00000033597

Gene Name

CASK interacting protein 1

Synonyms

C630036E02Rik, 3300002N10Rik

MMRRC Submission

044173-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5994 (G1)

Quality Score

215.009

Status

Not validated

Chromosome

Chromosomal Location

24488783-24508905 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24496961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 195 (L195P)

Ref Sequence

ENSEMBL: ENSMUSP00000024958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024958]

AlphaFold

Q6P9K8

Predicted Effect

probably damaging
Transcript: ENSMUST00000024958
AA Change: L195P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: L195P

Domain	Start	End	E-Value	Type
ANK	48	77	9.93e-5	SMART
ANK	81	110	1.9e-1	SMART
ANK	114	143	1.51e-4	SMART
ANK	147	176	1.15e0	SMART
ANK	188	217	2.6e-8	SMART
ANK	220	249	3.31e-1	SMART
SH3	284	346	3.62e-5	SMART
Pfam:Caskin1-CID	373	421	3e-26	PFAM
SAM	473	539	3.63e-15	SMART
SAM	542	609	5.41e-14	SMART
low complexity region	631	647	N/A	INTRINSIC
low complexity region	667	679	N/A	INTRINSIC
low complexity region	715	724	N/A	INTRINSIC
low complexity region	841	863	N/A	INTRINSIC
Pfam:Caskin-Pro-rich	878	966	3e-37	PFAM
low complexity region	1163	1168	N/A	INTRINSIC
low complexity region	1190	1216	N/A	INTRINSIC
low complexity region	1222	1232	N/A	INTRINSIC
low complexity region	1269	1288	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1315	1333	N/A	INTRINSIC
low complexity region	1344	1359	N/A	INTRINSIC
Pfam:Caskin-tail	1369	1431	7.2e-33	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,670,903	H1118L	probably benign	Het
Abca8b	A	G	11: 109,949,766		probably null	Het
Abcb5	A	T	12: 118,965,260		probably null	Het
Adcy6	A	T	15: 98,593,664	I1016N	probably damaging	Het
Afg3l2	A	T	18: 67,429,070	C312S	probably damaging	Het
Ano8	C	T	8: 71,484,834	V89M	probably damaging	Het
Arhgap21	C	T	2: 20,881,376	G330D	possibly damaging	Het
Cfap54	A	G	10: 93,039,081	I514T	probably damaging	Het
Ctdsp2	G	A	10: 126,995,820		probably benign	Het
Cyp4x1	T	C	4: 115,121,945	I152V	probably benign	Het
Dglucy	G	A	12: 100,842,700	R219Q	probably benign	Het
Disp3	G	T	4: 148,254,284	A810E	possibly damaging	Het
Dtx4	T	C	19: 12,501,153	Y22C	probably damaging	Het
Edaradd	A	T	13: 12,478,496	I105N	probably damaging	Het
Eepd1	C	T	9: 25,603,453	P519S	probably damaging	Het
Fscn3	A	T	6: 28,430,295	S155C	probably benign	Het
Gm10134	A	T	2: 28,506,246	E51V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golga7	T	C	8: 23,250,265	E83G	probably benign	Het
Gpr12	T	C	5: 146,583,431	H227R	probably damaging	Het
Hoxa2	T	G	6: 52,164,392	S85R	possibly damaging	Het
Hrnr	T	C	3: 93,332,300	S3282P	unknown	Het
Ift74	C	A	4: 94,691,724	T543K	possibly damaging	Het
Klf10	C	A	15: 38,296,041	R420L	probably damaging	Het
Krt77	T	A	15: 101,862,855	I338F	probably damaging	Het
Limch1	A	T	5: 66,974,622	S152C	probably damaging	Het
Mgat4e	T	A	1: 134,541,496	H270L	probably benign	Het
Myrf	A	T	19: 10,219,117	L504Q	probably null	Het
Nckipsd	A	G	9: 108,813,977	Q366R	probably benign	Het
Npy5r	A	T	8: 66,682,099	V14D	probably benign	Het
Nrap	T	A	19: 56,351,599	R830*	probably null	Het
Ogfrl1	A	T	1: 23,378,989	Y103N	probably damaging	Het
Olfr978	A	T	9: 39,994,223	R138*	probably null	Het
P2rx4	T	A	5: 122,725,079	L232H	probably damaging	Het
Pabpc2	A	T	18: 39,773,894	T71S	probably benign	Het
Paip2b	C	A	6: 83,808,885	S121I	probably damaging	Het
Pofut1	C	T	2: 153,261,229	T261I	possibly damaging	Het
Ppp6c	G	T	2: 39,210,992	T46K	possibly damaging	Het
Prkd2	C	A	7: 16,850,336	H371Q	probably benign	Het
Prrc2c	A	T	1: 162,674,156		probably null	Het
Psd3	C	T	8: 67,719,968	A894T	probably damaging	Het
Pygm	A	T	19: 6,398,043		probably null	Het
Pzp	A	T	6: 128,491,597	M989K	probably damaging	Het
Ralgapa2	A	T	2: 146,361,453	S1159T	probably benign	Het
Rapgefl1	T	C	11: 98,850,160	F575L	probably benign	Het
Rassf6	A	G	5: 90,617,768	L28S	probably damaging	Het
Rbp3	G	T	14: 33,954,900	K268N	probably damaging	Het
Rela	C	T	19: 5,647,064	T433M	possibly damaging	Het
Rnf103	T	A	6: 71,496,910	S102R	probably damaging	Het
Scarf2	A	G	16: 17,806,379	N516S	probably damaging	Het
Sdcbp2	T	C	2: 151,587,483	I241T	probably damaging	Het
Sept7	T	C	9: 25,288,198	I131T	possibly damaging	Het
Sh3pxd2b	T	C	11: 32,407,570	F191L	probably damaging	Het
Siglec15	C	A	18: 78,047,375	C236F	probably damaging	Het
Slc11a2	T	C	15: 100,397,681	T520A	probably benign	Het
Slc26a11	C	A	11: 119,379,912	F553L	probably benign	Het
Smchd1	G	A	17: 71,365,409	P1596S	possibly damaging	Het
Taar7b	A	G	10: 24,000,348	H137R	probably damaging	Het
Thap12	T	A	7: 98,716,030	C468*	probably null	Het
Timp4	C	T	6: 115,247,354	G118D	probably damaging	Het
Tnnt3	A	G	7: 142,511,266	K48E	probably damaging	Het
Trmt10a	T	A	3: 138,156,714	I255N	probably damaging	Het
Ttll10	T	C	4: 156,048,732		probably null	Het
Ube4b	A	G	4: 149,372,932	Y283H	probably damaging	Het
Ucp1	G	T	8: 83,293,938	V126L	possibly damaging	Het
Unc13b	T	A	4: 43,172,596		probably benign	Het
Vps13b	T	C	15: 35,875,772	S2768P	probably damaging	Het
Zcchc6	T	G	13: 59,789,209	Y806S	probably damaging	Het
Zfp101	T	A	17: 33,380,962	M607L	probably benign	Het
Zfp292	C	T	4: 34,805,464	V2527M	possibly damaging	Het
Zfp503	T	A	14: 21,985,562	T429S	possibly damaging	Het

Other mutations in Caskin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Caskin1	APN	17	24503889	missense	probably damaging	1.00
IGL00846:Caskin1	APN	17	24499349	critical splice donor site	probably null
IGL01120:Caskin1	APN	17	24505369	missense	possibly damaging	0.56
IGL01543:Caskin1	APN	17	24504548	missense	probably benign
IGL01622:Caskin1	APN	17	24503940	critical splice donor site	probably null
IGL01623:Caskin1	APN	17	24503940	critical splice donor site	probably null
IGL02120:Caskin1	APN	17	24500942	missense	probably damaging	1.00
IGL02816:Caskin1	APN	17	24502170	missense	probably benign	0.06
IGL02898:Caskin1	APN	17	24502409	missense	probably benign	0.00
IGL03353:Caskin1	APN	17	24499357	splice site	probably benign
PIT4151001:Caskin1	UTSW	17	24502219	missense	probably damaging	1.00
PIT4453001:Caskin1	UTSW	17	24499292	missense	probably damaging	1.00
R0057:Caskin1	UTSW	17	24504896	missense	probably damaging	1.00
R0057:Caskin1	UTSW	17	24504896	missense	probably damaging	1.00
R0190:Caskin1	UTSW	17	24504622	missense	possibly damaging	0.92
R0443:Caskin1	UTSW	17	24505400	missense	probably damaging	0.96
R0885:Caskin1	UTSW	17	24505694	missense	probably damaging	1.00
R1035:Caskin1	UTSW	17	24505037	missense	probably damaging	1.00
R1253:Caskin1	UTSW	17	24505073	missense	probably damaging	1.00
R1497:Caskin1	UTSW	17	24504541	nonsense	probably null
R1589:Caskin1	UTSW	17	24505478	splice site	probably null
R1651:Caskin1	UTSW	17	24502212	missense	possibly damaging	0.82
R1944:Caskin1	UTSW	17	24500771	missense	probably damaging	0.99
R1969:Caskin1	UTSW	17	24506850	missense	possibly damaging	0.94
R2057:Caskin1	UTSW	17	24496459	missense	probably damaging	0.99
R2127:Caskin1	UTSW	17	24496996	critical splice donor site	probably null
R2158:Caskin1	UTSW	17	24505154	missense	probably benign
R2402:Caskin1	UTSW	17	24503808	missense	probably damaging	1.00
R2895:Caskin1	UTSW	17	24489042	missense	probably damaging	1.00
R3423:Caskin1	UTSW	17	24499565	missense	probably damaging	0.98
R3800:Caskin1	UTSW	17	24501272	missense	probably benign
R4108:Caskin1	UTSW	17	24502147	missense	probably benign
R4419:Caskin1	UTSW	17	24504709	missense	probably damaging	1.00
R4510:Caskin1	UTSW	17	24506628	missense	probably benign	0.11
R4511:Caskin1	UTSW	17	24506628	missense	probably benign	0.11
R4552:Caskin1	UTSW	17	24506628	missense	probably benign	0.11
R4638:Caskin1	UTSW	17	24506628	missense	probably benign	0.11
R4642:Caskin1	UTSW	17	24506628	missense	probably benign	0.11
R4644:Caskin1	UTSW	17	24506628	missense	probably benign	0.11
R4824:Caskin1	UTSW	17	24501129	missense	probably benign	0.01
R4882:Caskin1	UTSW	17	24504415	missense	probably damaging	1.00
R4964:Caskin1	UTSW	17	24507161	missense	probably damaging	1.00
R4966:Caskin1	UTSW	17	24507161	missense	probably damaging	1.00
R5809:Caskin1	UTSW	17	24504547	missense	probably benign	0.06
R5841:Caskin1	UTSW	17	24496209	missense	probably damaging	0.99
R5877:Caskin1	UTSW	17	24505265	missense	possibly damaging	0.69
R5960:Caskin1	UTSW	17	24498895	missense	probably benign	0.31
R6022:Caskin1	UTSW	17	24496735	missense	probably benign	0.37
R6209:Caskin1	UTSW	17	24507121	missense	possibly damaging	0.84
R6228:Caskin1	UTSW	17	24507180	missense	probably damaging	0.99
R6287:Caskin1	UTSW	17	24496709	missense	probably damaging	1.00
R6497:Caskin1	UTSW	17	24504548	missense	probably benign
R6873:Caskin1	UTSW	17	24504179	missense	probably benign	0.31
R7079:Caskin1	UTSW	17	24498884	missense	probably benign	0.31
R7156:Caskin1	UTSW	17	24500683	splice site	probably null
R7385:Caskin1	UTSW	17	24503924	missense	probably damaging	1.00
R7953:Caskin1	UTSW	17	24504221	missense	probably damaging	1.00
R7993:Caskin1	UTSW	17	24499305	nonsense	probably null
R8410:Caskin1	UTSW	17	24502149	missense	possibly damaging	0.90
R8511:Caskin1	UTSW	17	24505936	missense	probably benign	0.12
R8749:Caskin1	UTSW	17	24504800	missense	probably benign	0.00
R8881:Caskin1	UTSW	17	24499299	missense	probably damaging	1.00
R8979:Caskin1	UTSW	17	24498925	missense	possibly damaging	0.51
R9005:Caskin1	UTSW	17	24499137	missense	probably benign	0.00
R9341:Caskin1	UTSW	17	24504473	missense	probably damaging	1.00
R9343:Caskin1	UTSW	17	24504473	missense	probably damaging	1.00
X0022:Caskin1	UTSW	17	24505166	missense	probably benign	0.34
X0063:Caskin1	UTSW	17	24507182	missense	probably damaging	1.00
Z1176:Caskin1	UTSW	17	24505038	missense	probably damaging	1.00
Z1177:Caskin1	UTSW	17	24496687	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCCTATCCTTTTCACCTGGGG -3'
(R):5'- GTGCTCTTAATTGCTGAACCC -3'

Sequencing Primer
(F):5'- ACCTGGGGTGGGGCTAG -3'
(R):5'- TTAGGGTCTCACATAGCCCAAGTG -3'

Posted On

2017-06-26