Incidental Mutation 'R5994:Smchd1'
ID 481035
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71672404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1596 (P1596S)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect possibly damaging
Transcript: ENSMUST00000127430
AA Change: P1596S

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: P1596S

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191623
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCGCTGCCATTTGTTG -3'
(R):5'- AGAGTCGGCCAGTGATTGTC -3'

Sequencing Primer
(F):5'- TGTTGCTGCTTCTTAACATCTAAG -3'
(R):5'- GTGATTGTCACGGTCACTTTTTAC -3'
Posted On 2017-06-26