Mutagenetix > Incidental Mutation

Incidental Mutation 'R5994:Afg3l2'

481037

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

044173-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5994 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 67429070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 312 (C312S)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: C312S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: C312S

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,670,903	H1118L	probably benign	Het
Abca8b	A	G	11: 109,949,766		probably null	Het
Abcb5	A	T	12: 118,965,260		probably null	Het
Adcy6	A	T	15: 98,593,664	I1016N	probably damaging	Het
Ano8	C	T	8: 71,484,834	V89M	probably damaging	Het
Arhgap21	C	T	2: 20,881,376	G330D	possibly damaging	Het
Caskin1	T	C	17: 24,496,961	L195P	probably damaging	Het
Cfap54	A	G	10: 93,039,081	I514T	probably damaging	Het
Ctdsp2	G	A	10: 126,995,820		probably benign	Het
Cyp4x1	T	C	4: 115,121,945	I152V	probably benign	Het
Dglucy	G	A	12: 100,842,700	R219Q	probably benign	Het
Disp3	G	T	4: 148,254,284	A810E	possibly damaging	Het
Dtx4	T	C	19: 12,501,153	Y22C	probably damaging	Het
Edaradd	A	T	13: 12,478,496	I105N	probably damaging	Het
Eepd1	C	T	9: 25,603,453	P519S	probably damaging	Het
Fscn3	A	T	6: 28,430,295	S155C	probably benign	Het
Gm10134	A	T	2: 28,506,246	E51V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golga7	T	C	8: 23,250,265	E83G	probably benign	Het
Gpr12	T	C	5: 146,583,431	H227R	probably damaging	Het
Hoxa2	T	G	6: 52,164,392	S85R	possibly damaging	Het
Hrnr	T	C	3: 93,332,300	S3282P	unknown	Het
Ift74	C	A	4: 94,691,724	T543K	possibly damaging	Het
Klf10	C	A	15: 38,296,041	R420L	probably damaging	Het
Krt77	T	A	15: 101,862,855	I338F	probably damaging	Het
Limch1	A	T	5: 66,974,622	S152C	probably damaging	Het
Mgat4e	T	A	1: 134,541,496	H270L	probably benign	Het
Myrf	A	T	19: 10,219,117	L504Q	probably null	Het
Nckipsd	A	G	9: 108,813,977	Q366R	probably benign	Het
Npy5r	A	T	8: 66,682,099	V14D	probably benign	Het
Nrap	T	A	19: 56,351,599	R830*	probably null	Het
Ogfrl1	A	T	1: 23,378,989	Y103N	probably damaging	Het
Olfr978	A	T	9: 39,994,223	R138*	probably null	Het
P2rx4	T	A	5: 122,725,079	L232H	probably damaging	Het
Pabpc2	A	T	18: 39,773,894	T71S	probably benign	Het
Paip2b	C	A	6: 83,808,885	S121I	probably damaging	Het
Pofut1	C	T	2: 153,261,229	T261I	possibly damaging	Het
Ppp6c	G	T	2: 39,210,992	T46K	possibly damaging	Het
Prkd2	C	A	7: 16,850,336	H371Q	probably benign	Het
Prrc2c	A	T	1: 162,674,156		probably null	Het
Psd3	C	T	8: 67,719,968	A894T	probably damaging	Het
Pygm	A	T	19: 6,398,043		probably null	Het
Pzp	A	T	6: 128,491,597	M989K	probably damaging	Het
Ralgapa2	A	T	2: 146,361,453	S1159T	probably benign	Het
Rapgefl1	T	C	11: 98,850,160	F575L	probably benign	Het
Rassf6	A	G	5: 90,617,768	L28S	probably damaging	Het
Rbp3	G	T	14: 33,954,900	K268N	probably damaging	Het
Rela	C	T	19: 5,647,064	T433M	possibly damaging	Het
Rnf103	T	A	6: 71,496,910	S102R	probably damaging	Het
Scarf2	A	G	16: 17,806,379	N516S	probably damaging	Het
Sdcbp2	T	C	2: 151,587,483	I241T	probably damaging	Het
Sept7	T	C	9: 25,288,198	I131T	possibly damaging	Het
Sh3pxd2b	T	C	11: 32,407,570	F191L	probably damaging	Het
Siglec15	C	A	18: 78,047,375	C236F	probably damaging	Het
Slc11a2	T	C	15: 100,397,681	T520A	probably benign	Het
Slc26a11	C	A	11: 119,379,912	F553L	probably benign	Het
Smchd1	G	A	17: 71,365,409	P1596S	possibly damaging	Het
Taar7b	A	G	10: 24,000,348	H137R	probably damaging	Het
Thap12	T	A	7: 98,716,030	C468*	probably null	Het
Timp4	C	T	6: 115,247,354	G118D	probably damaging	Het
Tnnt3	A	G	7: 142,511,266	K48E	probably damaging	Het
Trmt10a	T	A	3: 138,156,714	I255N	probably damaging	Het
Ttll10	T	C	4: 156,048,732		probably null	Het
Ube4b	A	G	4: 149,372,932	Y283H	probably damaging	Het
Ucp1	G	T	8: 83,293,938	V126L	possibly damaging	Het
Unc13b	T	A	4: 43,172,596		probably benign	Het
Vps13b	T	C	15: 35,875,772	S2768P	probably damaging	Het
Zcchc6	T	G	13: 59,789,209	Y806S	probably damaging	Het
Zfp101	T	A	17: 33,380,962	M607L	probably benign	Het
Zfp292	C	T	4: 34,805,464	V2527M	possibly damaging	Het
Zfp503	T	A	14: 21,985,562	T429S	possibly damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TGAACAACGAGTTGACTAGGTC -3'
(R):5'- CACAGGAAACTCAGCAGCTG -3'

Sequencing Primer
(F):5'- CAACGAGTTGACTAGGTCATTAGTG -3'
(R):5'- CAGGAAACTCAGCAGCTGAACTG -3'

Posted On

2017-06-26