Incidental Mutation 'R5994:Pygm'
ID481040
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 6398043 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000035716] [ENSMUST00000113467] [ENSMUST00000113468] [ENSMUST00000113469] [ENSMUST00000113471] [ENSMUST00000113472] [ENSMUST00000113475] [ENSMUST00000113476] [ENSMUST00000113483] [ENSMUST00000113483] [ENSMUST00000146601] [ENSMUST00000146831] [ENSMUST00000138555] [ENSMUST00000150713] [ENSMUST00000127021] [ENSMUST00000139522] [ENSMUST00000167240]
Predicted Effect probably null
Transcript: ENSMUST00000035269
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035716
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113467
SMART Domains Protein: ENSMUSP00000109095
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113468
SMART Domains Protein: ENSMUSP00000109096
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 97 1.93e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113469
SMART Domains Protein: ENSMUSP00000109097
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113471
SMART Domains Protein: ENSMUSP00000109099
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113472
SMART Domains Protein: ENSMUSP00000109100
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113475
SMART Domains Protein: ENSMUSP00000109103
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113476
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113483
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113483
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145611
Predicted Effect probably benign
Transcript: ENSMUST00000146601
SMART Domains Protein: ENSMUSP00000117681
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 58 1e-35 BLAST
SCOP:d1bkds_ 9 58 1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146831
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138555
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150713
SMART Domains Protein: ENSMUSP00000120949
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 95 6.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167240
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
R8093:Pygm UTSW 19 6386042 missense probably damaging 1.00
R8351:Pygm UTSW 19 6388087 missense possibly damaging 0.83
R8499:Pygm UTSW 19 6390362 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCTTTGACCTCACAGAG -3'
(R):5'- TGCAAACAGACTCAAGGGCG -3'

Sequencing Primer
(F):5'- CCTCTAGGTTTAAAGTCTTTGCAG -3'
(R):5'- CAGACTCAAGGGCGGGTATG -3'
Posted On2017-06-26