Incidental Mutation 'R5994:Pygm'
ID 481040
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Name muscle glycogen phosphorylase
Synonyms PG
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 6434438-6448494 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 6448073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000035716] [ENSMUST00000113467] [ENSMUST00000113468] [ENSMUST00000113469] [ENSMUST00000113471] [ENSMUST00000113472] [ENSMUST00000113475] [ENSMUST00000113476] [ENSMUST00000113483] [ENSMUST00000113483] [ENSMUST00000146601] [ENSMUST00000146831] [ENSMUST00000138555] [ENSMUST00000150713] [ENSMUST00000127021] [ENSMUST00000139522] [ENSMUST00000167240]
AlphaFold Q9WUB3
Predicted Effect probably null
Transcript: ENSMUST00000035269
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035716
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113467
SMART Domains Protein: ENSMUSP00000109095
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113468
SMART Domains Protein: ENSMUSP00000109096
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 97 1.93e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113469
SMART Domains Protein: ENSMUSP00000109097
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113471
SMART Domains Protein: ENSMUSP00000109099
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113472
SMART Domains Protein: ENSMUSP00000109100
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113475
SMART Domains Protein: ENSMUSP00000109103
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113476
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113483
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113483
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123661
Predicted Effect probably benign
Transcript: ENSMUST00000146601
SMART Domains Protein: ENSMUSP00000117681
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 58 1e-35 BLAST
SCOP:d1bkds_ 9 58 1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146831
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138555
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150713
SMART Domains Protein: ENSMUSP00000120949
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 95 6.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167240
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6,441,424 (GRCm39) missense probably benign
IGL01743:Pygm APN 19 6,443,024 (GRCm39) splice site probably null
IGL01827:Pygm APN 19 6,440,407 (GRCm39) missense probably damaging 1.00
IGL02032:Pygm APN 19 6,438,117 (GRCm39) missense probably benign 0.23
IGL02261:Pygm APN 19 6,438,301 (GRCm39) missense probably damaging 1.00
IGL02431:Pygm APN 19 6,438,148 (GRCm39) missense probably damaging 1.00
IGL02511:Pygm APN 19 6,435,718 (GRCm39) missense probably benign 0.22
IGL02967:Pygm APN 19 6,443,868 (GRCm39) missense probably damaging 1.00
IGL03081:Pygm APN 19 6,438,851 (GRCm39) missense possibly damaging 0.53
R0336:Pygm UTSW 19 6,438,788 (GRCm39) missense probably damaging 1.00
R0415:Pygm UTSW 19 6,441,396 (GRCm39) missense probably benign 0.06
R0799:Pygm UTSW 19 6,436,048 (GRCm39) intron probably benign
R1445:Pygm UTSW 19 6,439,917 (GRCm39) missense probably benign 0.20
R1752:Pygm UTSW 19 6,441,064 (GRCm39) missense probably damaging 0.99
R1828:Pygm UTSW 19 6,447,637 (GRCm39) missense possibly damaging 0.72
R2054:Pygm UTSW 19 6,438,185 (GRCm39) missense probably benign 0.02
R2086:Pygm UTSW 19 6,441,511 (GRCm39) critical splice donor site probably null
R2116:Pygm UTSW 19 6,436,438 (GRCm39) missense probably damaging 0.98
R2431:Pygm UTSW 19 6,443,815 (GRCm39) missense probably damaging 1.00
R2516:Pygm UTSW 19 6,447,631 (GRCm39) missense probably benign 0.20
R3938:Pygm UTSW 19 6,442,980 (GRCm39) missense probably benign 0.42
R4609:Pygm UTSW 19 6,441,439 (GRCm39) missense possibly damaging 0.92
R4924:Pygm UTSW 19 6,443,754 (GRCm39) missense probably damaging 1.00
R4995:Pygm UTSW 19 6,448,169 (GRCm39) missense probably damaging 1.00
R5225:Pygm UTSW 19 6,439,494 (GRCm39) missense probably benign 0.01
R5296:Pygm UTSW 19 6,434,609 (GRCm39) missense probably damaging 1.00
R5437:Pygm UTSW 19 6,440,412 (GRCm39) missense probably damaging 1.00
R6030:Pygm UTSW 19 6,438,842 (GRCm39) missense possibly damaging 0.78
R6030:Pygm UTSW 19 6,438,842 (GRCm39) missense possibly damaging 0.78
R6188:Pygm UTSW 19 6,447,967 (GRCm39) splice site probably null
R6266:Pygm UTSW 19 6,448,169 (GRCm39) missense probably damaging 1.00
R6799:Pygm UTSW 19 6,448,157 (GRCm39) missense probably damaging 1.00
R6855:Pygm UTSW 19 6,443,787 (GRCm39) missense probably damaging 1.00
R6856:Pygm UTSW 19 6,443,787 (GRCm39) missense probably damaging 1.00
R6857:Pygm UTSW 19 6,443,787 (GRCm39) missense probably damaging 1.00
R7223:Pygm UTSW 19 6,438,893 (GRCm39) missense probably benign
R7256:Pygm UTSW 19 6,435,926 (GRCm39) missense probably benign 0.01
R7263:Pygm UTSW 19 6,438,357 (GRCm39) missense probably damaging 1.00
R7398:Pygm UTSW 19 6,435,966 (GRCm39) missense probably damaging 1.00
R8093:Pygm UTSW 19 6,436,072 (GRCm39) missense probably damaging 1.00
R8351:Pygm UTSW 19 6,438,117 (GRCm39) missense possibly damaging 0.83
R8499:Pygm UTSW 19 6,440,392 (GRCm39) missense probably damaging 0.99
R8967:Pygm UTSW 19 6,434,744 (GRCm39) missense probably damaging 1.00
R9331:Pygm UTSW 19 6,448,129 (GRCm39) missense probably damaging 1.00
R9656:Pygm UTSW 19 6,438,187 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTTGACCTCACAGAG -3'
(R):5'- TGCAAACAGACTCAAGGGCG -3'

Sequencing Primer
(F):5'- CCTCTAGGTTTAAAGTCTTTGCAG -3'
(R):5'- CAGACTCAAGGGCGGGTATG -3'
Posted On 2017-06-26