Incidental Mutation 'R5994:Myrf'
ID481041
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10219117 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 504 (L504Q)
Ref Sequence ENSEMBL: ENSMUSP00000139601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably null
Transcript: ENSMUST00000088013
AA Change: L504Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: L504Q

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186056
AA Change: L302Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: L302Q

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186854
Predicted Effect probably null
Transcript: ENSMUST00000189897
AA Change: L504Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: L504Q

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
R7585:Myrf UTSW 19 10216727 missense probably damaging 1.00
R7838:Myrf UTSW 19 10219619 missense possibly damaging 0.55
R8340:Myrf UTSW 19 10215341 missense probably benign 0.01
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Z1177:Myrf UTSW 19 10219544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCCTAGACAGGATGAC -3'
(R):5'- CCCTAGTGGAGGCTCATATTTC -3'

Sequencing Primer
(F):5'- ATGCAGCCACTGTCCAGC -3'
(R):5'- CTCCTCTGTGGGATACTGTGATAAC -3'
Posted On2017-06-26