Incidental Mutation 'R5995:Kdelc2'
ID481070
Institutional Source Beutler Lab
Gene Symbol Kdelc2
Ensembl Gene ENSMUSG00000034487
Gene NameKDEL (Lys-Asp-Glu-Leu) containing 2
Synonyms
MMRRC Submission 044174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5995 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53384025-53401867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53395895 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 380 (Y380H)
Ref Sequence ENSEMBL: ENSMUSP00000039313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037853] [ENSMUST00000214164]
Predicted Effect probably damaging
Transcript: ENSMUST00000037853
AA Change: Y380H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039313
Gene: ENSMUSG00000034487
AA Change: Y380H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG_FLMN 23 132 2.17e-2 SMART
Blast:CAP10 135 224 5e-48 BLAST
CAP10 226 471 7.45e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184489
Predicted Effect probably benign
Transcript: ENSMUST00000214164
Meta Mutation Damage Score 0.5325 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Adgrb2 C A 4: 130,017,103 A1104E probably damaging Het
Adgrv1 A G 13: 81,466,259 V4005A probably benign Het
Bend6 T C 1: 33,878,439 probably null Het
Brwd1 A T 16: 96,064,787 V265E probably damaging Het
Ccdc96 A G 5: 36,486,374 I575V probably damaging Het
Cd109 A T 9: 78,700,279 I1094L probably benign Het
Cd44 A G 2: 102,861,670 V91A probably damaging Het
Cdv3 C G 9: 103,364,003 G122R probably damaging Het
Ces2c T A 8: 104,850,901 V272D possibly damaging Het
Colgalt1 T A 8: 71,623,110 M467K probably damaging Het
Crtam G A 9: 40,994,540 T31M possibly damaging Het
Cyp7a1 C T 4: 6,272,371 V281M possibly damaging Het
Dnah7a A T 1: 53,620,670 N726K probably benign Het
Dok6 T C 18: 89,421,018 E232G possibly damaging Het
Gm12185 T C 11: 48,915,713 E217G probably benign Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gria1 A T 11: 57,289,285 Y618F probably damaging Het
H2-T22 A G 17: 36,041,485 Y183H probably benign Het
Hace1 A T 10: 45,670,391 I374L probably benign Het
Hif3a T A 7: 17,053,769 T132S probably benign Het
Hoxa3 T A 6: 52,170,283 probably benign Het
Il27 A C 7: 126,589,363 probably benign Het
Klhdc1 T C 12: 69,250,774 Y40H probably damaging Het
Klhl33 T G 14: 50,892,651 E462A possibly damaging Het
Myh10 T C 11: 68,814,983 I1979T probably benign Het
Nfkbil1 G T 17: 35,220,798 F246L probably benign Het
Nlrp1b A T 11: 71,181,746 F424I probably damaging Het
Nod1 A G 6: 54,944,554 Y260H probably damaging Het
Ofcc1 A G 13: 40,280,422 L69P probably damaging Het
Olfr1110 T C 2: 87,135,856 N155S probably damaging Het
Olfr1419 A T 19: 11,870,862 I118N possibly damaging Het
Olfr1446 A C 19: 12,890,597 probably null Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Olfr968 A G 9: 39,772,692 V36A probably benign Het
Olfr98 C A 17: 37,263,648 Q5H probably benign Het
Onecut2 G T 18: 64,341,548 R390L probably damaging Het
Oprm1 A C 10: 6,832,520 M388L probably benign Het
Pcdhgc5 T A 18: 37,821,060 Y462* probably null Het
Pex1 T A 5: 3,607,704 M425K possibly damaging Het
Plec A T 15: 76,185,905 Y1001N probably damaging Het
Pou2f2 T G 7: 25,097,444 K236Q probably damaging Het
Rbm20 G A 19: 53,851,267 E896K possibly damaging Het
Sh3tc2 T A 18: 61,990,010 L614Q probably damaging Het
Skint5 T A 4: 113,893,832 I339F unknown Het
Slc2a7 T C 4: 150,168,340 I479T probably damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Supt20 T C 3: 54,709,053 S245P probably damaging Het
Ttn A G 2: 76,761,292 I21011T probably damaging Het
Vmn2r11 T A 5: 109,047,055 I802F probably damaging Het
Vmn2r92 T C 17: 18,168,951 probably null Het
Ythdc2 T A 18: 44,886,253 M1363K probably damaging Het
Zan T C 5: 137,378,809 probably benign Het
Zfp521 C A 18: 13,717,624 C1261F probably damaging Het
Zfp980 A T 4: 145,701,909 K403* probably null Het
Other mutations in Kdelc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdelc2 APN 9 53398028 intron probably benign
IGL00334:Kdelc2 APN 9 53398030 intron probably benign
IGL01061:Kdelc2 APN 9 53388587 unclassified probably benign
IGL01114:Kdelc2 APN 9 53388579 critical splice donor site probably null
IGL02227:Kdelc2 APN 9 53388479 missense probably damaging 0.97
IGL02646:Kdelc2 APN 9 53384251 missense probably benign 0.06
IGL02795:Kdelc2 APN 9 53392105 missense probably damaging 1.00
IGL03029:Kdelc2 APN 9 53384288 critical splice donor site probably null
R0830:Kdelc2 UTSW 9 53390711 missense probably damaging 1.00
R1256:Kdelc2 UTSW 9 53388462 missense possibly damaging 0.62
R1806:Kdelc2 UTSW 9 53395850 missense probably damaging 1.00
R6170:Kdelc2 UTSW 9 53399742 missense possibly damaging 0.91
R6348:Kdelc2 UTSW 9 53390440 missense probably damaging 0.97
R6833:Kdelc2 UTSW 9 53392008 missense possibly damaging 0.52
R7250:Kdelc2 UTSW 9 53390521 nonsense probably null
R7403:Kdelc2 UTSW 9 53390441 missense probably damaging 1.00
R8089:Kdelc2 UTSW 9 53395962 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTGTTAAAGGCTGGCTAAC -3'
(R):5'- TATCCTAATGGAACTCAGTTTCCC -3'

Sequencing Primer
(F):5'- AGGCTGGCTAACATTTTATACAAAG -3'
(R):5'- CGAGGTTTCTCTTAATGGGA -3'
Posted On2017-06-26