Incidental Mutation 'R5996:Slc7a14'
ID481111
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 044175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5996 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31209236 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 719 (D719G)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259]
Predicted Effect probably benign
Transcript: ENSMUST00000091259
AA Change: D719G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: D719G

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,518,928 M1T probably null Het
4932438A13Rik T C 3: 36,931,116 F865S probably benign Het
A2m T A 6: 121,659,394 W741R probably damaging Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acan A G 7: 79,111,320 T1927A probably damaging Het
Agbl4 A G 4: 110,955,672 probably null Het
Ccr8 T A 9: 120,094,463 C215S probably damaging Het
Cd209b T C 8: 3,918,688 T314A probably benign Het
Cd244 T G 1: 171,581,640 probably null Het
Cdh23 T C 10: 60,413,577 E849G possibly damaging Het
Cep57 A G 9: 13,809,879 V268A probably damaging Het
Clip4 T C 17: 71,856,310 S626P probably damaging Het
Col19a1 C T 1: 24,328,071 G477R probably damaging Het
Col4a4 T C 1: 82,455,728 D1498G unknown Het
Coro6 T C 11: 77,466,496 V177A probably benign Het
Crip3 T C 17: 46,431,284 S202P possibly damaging Het
Cxcr2 T C 1: 74,158,460 C38R probably damaging Het
Cyp4f13 C T 17: 32,929,473 G327R possibly damaging Het
Dab2 C T 15: 6,435,311 Q415* probably null Het
Dennd5b A G 6: 149,068,095 F287L probably benign Het
Dlg4 G A 11: 70,017,231 R6K probably benign Het
Edc4 A G 8: 105,887,401 K429E probably damaging Het
Fam107b T A 2: 3,779,630 probably null Het
Flt4 A T 11: 49,651,070 D1360V probably damaging Het
Gm1043 A T 5: 37,159,824 probably benign Het
Gm35060 G T 18: 32,462,492 probably benign Het
Gm4894 A T 9: 49,278,670 I82L unknown Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gpr176 A C 2: 118,283,904 probably null Het
Gtse1 T C 15: 85,864,180 L262P probably benign Het
Il4ra T C 7: 125,567,221 W46R probably damaging Het
Itga11 A G 9: 62,755,673 Y557C probably benign Het
Kcnab2 A C 4: 152,434,830 probably null Het
Kcnh7 G A 2: 63,184,097 probably benign Het
Ly9 T A 1: 171,601,828 Q230L probably damaging Het
Map2 C A 1: 66,414,884 H978N possibly damaging Het
Map2k6 A G 11: 110,497,906 I225V possibly damaging Het
Map3k13 A G 16: 21,905,245 N326D possibly damaging Het
Mdga2 A G 12: 66,797,763 F85L probably benign Het
Mmp13 C T 9: 7,274,269 P192L probably damaging Het
Mrpl37 T C 4: 107,066,507 T97A probably benign Het
Mycbpap C T 11: 94,513,594 G121D probably benign Het
Nabp1 A G 1: 51,471,385 S153P probably benign Het
Nsun3 A T 16: 62,769,686 F222I probably benign Het
Olfr735 A G 14: 50,345,512 V310A possibly damaging Het
Pcdhga4 A T 18: 37,685,938 D180V probably benign Het
Pex6 C A 17: 46,714,458 probably null Het
Phrf1 C A 7: 141,259,102 probably benign Het
Ppp1r36 A G 12: 76,439,162 T365A possibly damaging Het
Ranbp10 A G 8: 105,773,040 M519T probably benign Het
Rfx4 G A 10: 84,840,017 W32* probably null Het
Ryr1 T C 7: 29,024,241 N4131S probably benign Het
Slc27a6 A G 18: 58,612,234 E580G possibly damaging Het
Slfn9 A G 11: 82,987,484 I273T possibly damaging Het
Spice1 A G 16: 44,384,674 E781G probably benign Het
Sspo C T 6: 48,494,176 P4686S possibly damaging Het
Stab1 G T 14: 31,139,551 R2500S probably benign Het
Stox2 A T 8: 47,203,147 M98K possibly damaging Het
Tacc2 T C 7: 130,623,483 S633P probably damaging Het
Tm9sf4 T C 2: 153,195,571 probably null Het
Togaram2 T A 17: 71,704,783 F486I probably damaging Het
Trappc12 A G 12: 28,747,114 S140P possibly damaging Het
Ttc29 A T 8: 78,276,896 N247I probably damaging Het
Uso1 A T 5: 92,192,730 E668D probably benign Het
Vmn2r69 A T 7: 85,411,909 probably null Het
Xirp2 T A 2: 67,511,650 L1412I possibly damaging Het
Xrcc5 T A 1: 72,310,458 D15E probably damaging Het
Zfp661 T C 2: 127,577,048 K391E probably damaging Het
Zfp729b A G 13: 67,593,858 I106T probably benign Het
Zfyve9 A C 4: 108,719,360 S175A probably benign Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTTAGTCTTACTCCGGAGAGC -3'
(R):5'- AGCCCTAGTCAGGTGTGATCTC -3'

Sequencing Primer
(F):5'- CGGAGAGCAATCTAACTCGTCATTTG -3'
(R):5'- TAGTCAGGTGTGATCTCCCCAG -3'
Posted On2017-06-26