Incidental Mutation 'R5996:Zfyve9'
ID481114
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission 044175-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R5996 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108719360 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 175 (S175A)
Ref Sequence ENSEMBL: ENSMUSP00000102268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658] [ENSMUST00000178992]
Predicted Effect probably benign
Transcript: ENSMUST00000042185
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106657
AA Change: S175A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: S175A

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106658
AA Change: S175A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: S175A

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178992
SMART Domains Protein: ENSMUSP00000136370
Gene: ENSMUSG00000094958

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 114 148 N/A INTRINSIC
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,518,928 M1T probably null Het
4932438A13Rik T C 3: 36,931,116 F865S probably benign Het
A2m T A 6: 121,659,394 W741R probably damaging Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acan A G 7: 79,111,320 T1927A probably damaging Het
Agbl4 A G 4: 110,955,672 probably null Het
Ccr8 T A 9: 120,094,463 C215S probably damaging Het
Cd209b T C 8: 3,918,688 T314A probably benign Het
Cd244 T G 1: 171,581,640 probably null Het
Cdh23 T C 10: 60,413,577 E849G possibly damaging Het
Cep57 A G 9: 13,809,879 V268A probably damaging Het
Clip4 T C 17: 71,856,310 S626P probably damaging Het
Col19a1 C T 1: 24,328,071 G477R probably damaging Het
Col4a4 T C 1: 82,455,728 D1498G unknown Het
Coro6 T C 11: 77,466,496 V177A probably benign Het
Crip3 T C 17: 46,431,284 S202P possibly damaging Het
Cxcr2 T C 1: 74,158,460 C38R probably damaging Het
Cyp4f13 C T 17: 32,929,473 G327R possibly damaging Het
Dab2 C T 15: 6,435,311 Q415* probably null Het
Dennd5b A G 6: 149,068,095 F287L probably benign Het
Dlg4 G A 11: 70,017,231 R6K probably benign Het
Edc4 A G 8: 105,887,401 K429E probably damaging Het
Fam107b T A 2: 3,779,630 probably null Het
Flt4 A T 11: 49,651,070 D1360V probably damaging Het
Gm1043 A T 5: 37,159,824 probably benign Het
Gm35060 G T 18: 32,462,492 probably benign Het
Gm4894 A T 9: 49,278,670 I82L unknown Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gpr176 A C 2: 118,283,904 probably null Het
Gtse1 T C 15: 85,864,180 L262P probably benign Het
Il4ra T C 7: 125,567,221 W46R probably damaging Het
Itga11 A G 9: 62,755,673 Y557C probably benign Het
Kcnab2 A C 4: 152,434,830 probably null Het
Kcnh7 G A 2: 63,184,097 probably benign Het
Ly9 T A 1: 171,601,828 Q230L probably damaging Het
Map2 C A 1: 66,414,884 H978N possibly damaging Het
Map2k6 A G 11: 110,497,906 I225V possibly damaging Het
Map3k13 A G 16: 21,905,245 N326D possibly damaging Het
Mdga2 A G 12: 66,797,763 F85L probably benign Het
Mmp13 C T 9: 7,274,269 P192L probably damaging Het
Mrpl37 T C 4: 107,066,507 T97A probably benign Het
Mycbpap C T 11: 94,513,594 G121D probably benign Het
Nabp1 A G 1: 51,471,385 S153P probably benign Het
Nsun3 A T 16: 62,769,686 F222I probably benign Het
Olfr735 A G 14: 50,345,512 V310A possibly damaging Het
Pcdhga4 A T 18: 37,685,938 D180V probably benign Het
Pex6 C A 17: 46,714,458 probably null Het
Phrf1 C A 7: 141,259,102 probably benign Het
Ppp1r36 A G 12: 76,439,162 T365A possibly damaging Het
Ranbp10 A G 8: 105,773,040 M519T probably benign Het
Rfx4 G A 10: 84,840,017 W32* probably null Het
Ryr1 T C 7: 29,024,241 N4131S probably benign Het
Slc27a6 A G 18: 58,612,234 E580G possibly damaging Het
Slc7a14 T C 3: 31,209,236 D719G probably benign Het
Slfn9 A G 11: 82,987,484 I273T possibly damaging Het
Spice1 A G 16: 44,384,674 E781G probably benign Het
Sspo C T 6: 48,494,176 P4686S possibly damaging Het
Stab1 G T 14: 31,139,551 R2500S probably benign Het
Stox2 A T 8: 47,203,147 M98K possibly damaging Het
Tacc2 T C 7: 130,623,483 S633P probably damaging Het
Tm9sf4 T C 2: 153,195,571 probably null Het
Togaram2 T A 17: 71,704,783 F486I probably damaging Het
Trappc12 A G 12: 28,747,114 S140P possibly damaging Het
Ttc29 A T 8: 78,276,896 N247I probably damaging Het
Uso1 A T 5: 92,192,730 E668D probably benign Het
Vmn2r69 A T 7: 85,411,909 probably null Het
Xirp2 T A 2: 67,511,650 L1412I possibly damaging Het
Xrcc5 T A 1: 72,310,458 D15E probably damaging Het
Zfp661 T C 2: 127,577,048 K391E probably damaging Het
Zfp729b A G 13: 67,593,858 I106T probably benign Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108719764 nonsense probably null
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108680986 missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108727491 splice site probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R6315:Zfyve9 UTSW 4 108674488 missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108639269 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108656954 missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108718547 missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108718256 missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108719015 missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108693318 critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108691776 missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108719101 missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108684995 missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108685018 missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108650277 missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108719680 missense possibly damaging 0.77
R8682:Zfyve9 UTSW 4 108719342 missense probably benign 0.30
R8948:Zfyve9 UTSW 4 108642091 missense possibly damaging 0.84
R8960:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
Z1176:Zfyve9 UTSW 4 108642207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCGCACAGAGATGATTCACAG -3'
(R):5'- GAGACTGACACCATGTGGATTG -3'

Sequencing Primer
(F):5'- GAGATGATTCACAGAATCCCTCTCTG -3'
(R):5'- CACCATGTGGATTGATGAAAATGCTG -3'
Posted On2017-06-26