Incidental Mutation 'R5996:Itga11'
ID481134
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission 044175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5996 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62755673 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 557 (Y557C)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: Y557C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: Y557C

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Meta Mutation Damage Score 0.3727 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,518,928 M1T probably null Het
4932438A13Rik T C 3: 36,931,116 F865S probably benign Het
A2m T A 6: 121,659,394 W741R probably damaging Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acan A G 7: 79,111,320 T1927A probably damaging Het
Agbl4 A G 4: 110,955,672 probably null Het
Ccr8 T A 9: 120,094,463 C215S probably damaging Het
Cd209b T C 8: 3,918,688 T314A probably benign Het
Cd244 T G 1: 171,581,640 probably null Het
Cdh23 T C 10: 60,413,577 E849G possibly damaging Het
Cep57 A G 9: 13,809,879 V268A probably damaging Het
Clip4 T C 17: 71,856,310 S626P probably damaging Het
Col19a1 C T 1: 24,328,071 G477R probably damaging Het
Col4a4 T C 1: 82,455,728 D1498G unknown Het
Coro6 T C 11: 77,466,496 V177A probably benign Het
Crip3 T C 17: 46,431,284 S202P possibly damaging Het
Cxcr2 T C 1: 74,158,460 C38R probably damaging Het
Cyp4f13 C T 17: 32,929,473 G327R possibly damaging Het
Dab2 C T 15: 6,435,311 Q415* probably null Het
Dennd5b A G 6: 149,068,095 F287L probably benign Het
Dlg4 G A 11: 70,017,231 R6K probably benign Het
Edc4 A G 8: 105,887,401 K429E probably damaging Het
Fam107b T A 2: 3,779,630 probably null Het
Flt4 A T 11: 49,651,070 D1360V probably damaging Het
Gm1043 A T 5: 37,159,824 probably benign Het
Gm35060 G T 18: 32,462,492 probably benign Het
Gm4894 A T 9: 49,278,670 I82L unknown Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gpr176 A C 2: 118,283,904 probably null Het
Gtse1 T C 15: 85,864,180 L262P probably benign Het
Il4ra T C 7: 125,567,221 W46R probably damaging Het
Kcnab2 A C 4: 152,434,830 probably null Het
Kcnh7 G A 2: 63,184,097 probably benign Het
Ly9 T A 1: 171,601,828 Q230L probably damaging Het
Map2 C A 1: 66,414,884 H978N possibly damaging Het
Map2k6 A G 11: 110,497,906 I225V possibly damaging Het
Map3k13 A G 16: 21,905,245 N326D possibly damaging Het
Mdga2 A G 12: 66,797,763 F85L probably benign Het
Mmp13 C T 9: 7,274,269 P192L probably damaging Het
Mrpl37 T C 4: 107,066,507 T97A probably benign Het
Mycbpap C T 11: 94,513,594 G121D probably benign Het
Nabp1 A G 1: 51,471,385 S153P probably benign Het
Nsun3 A T 16: 62,769,686 F222I probably benign Het
Olfr735 A G 14: 50,345,512 V310A possibly damaging Het
Pcdhga4 A T 18: 37,685,938 D180V probably benign Het
Pex6 C A 17: 46,714,458 probably null Het
Phrf1 C A 7: 141,259,102 probably benign Het
Ppp1r36 A G 12: 76,439,162 T365A possibly damaging Het
Ranbp10 A G 8: 105,773,040 M519T probably benign Het
Rfx4 G A 10: 84,840,017 W32* probably null Het
Ryr1 T C 7: 29,024,241 N4131S probably benign Het
Slc27a6 A G 18: 58,612,234 E580G possibly damaging Het
Slc7a14 T C 3: 31,209,236 D719G probably benign Het
Slfn9 A G 11: 82,987,484 I273T possibly damaging Het
Spice1 A G 16: 44,384,674 E781G probably benign Het
Sspo C T 6: 48,494,176 P4686S possibly damaging Het
Stab1 G T 14: 31,139,551 R2500S probably benign Het
Stox2 A T 8: 47,203,147 M98K possibly damaging Het
Tacc2 T C 7: 130,623,483 S633P probably damaging Het
Tm9sf4 T C 2: 153,195,571 probably null Het
Togaram2 T A 17: 71,704,783 F486I probably damaging Het
Trappc12 A G 12: 28,747,114 S140P possibly damaging Het
Ttc29 A T 8: 78,276,896 N247I probably damaging Het
Uso1 A T 5: 92,192,730 E668D probably benign Het
Vmn2r69 A T 7: 85,411,909 probably null Het
Xirp2 T A 2: 67,511,650 L1412I possibly damaging Het
Xrcc5 T A 1: 72,310,458 D15E probably damaging Het
Zfp661 T C 2: 127,577,048 K391E probably damaging Het
Zfp729b A G 13: 67,593,858 I106T probably benign Het
Zfyve9 A C 4: 108,719,360 S175A probably benign Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATCAGGATGGGTTCTGGAAG -3'
(R):5'- TAGGACAGGCAGGATCCTTC -3'

Sequencing Primer
(F):5'- ATGGGTTCTGGAAGATGGAATG -3'
(R):5'- TTCCTGTAGGAGGCCATGACAG -3'
Posted On2017-06-26