Incidental Mutation 'R5996:Olfr735'
ID 481151
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Name olfactory receptor 735
Synonyms MOR243-1, GA_x6K02T2PMLR-6042130-6041183
MMRRC Submission 044175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R5996 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50342612-50348872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50345512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 310 (V310A)
Ref Sequence ENSEMBL: ENSMUSP00000056851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
AlphaFold Q7TRM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000049729
AA Change: V310A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: V310A

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206546
Predicted Effect possibly damaging
Transcript: ENSMUST00000216634
AA Change: V279A

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,518,928 M1T probably null Het
4932438A13Rik T C 3: 36,931,116 F865S probably benign Het
A2m T A 6: 121,659,394 W741R probably damaging Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acan A G 7: 79,111,320 T1927A probably damaging Het
Agbl4 A G 4: 110,955,672 probably null Het
Ccr8 T A 9: 120,094,463 C215S probably damaging Het
Cd209b T C 8: 3,918,688 T314A probably benign Het
Cd244 T G 1: 171,581,640 probably null Het
Cdh23 T C 10: 60,413,577 E849G possibly damaging Het
Cep57 A G 9: 13,809,879 V268A probably damaging Het
Clip4 T C 17: 71,856,310 S626P probably damaging Het
Col19a1 C T 1: 24,328,071 G477R probably damaging Het
Col4a4 T C 1: 82,455,728 D1498G unknown Het
Coro6 T C 11: 77,466,496 V177A probably benign Het
Crip3 T C 17: 46,431,284 S202P possibly damaging Het
Cxcr2 T C 1: 74,158,460 C38R probably damaging Het
Cyp4f13 C T 17: 32,929,473 G327R possibly damaging Het
Dab2 C T 15: 6,435,311 Q415* probably null Het
Dennd5b A G 6: 149,068,095 F287L probably benign Het
Dlg4 G A 11: 70,017,231 R6K probably benign Het
Edc4 A G 8: 105,887,401 K429E probably damaging Het
Fam107b T A 2: 3,779,630 probably null Het
Flt4 A T 11: 49,651,070 D1360V probably damaging Het
Gm1043 A T 5: 37,159,824 probably benign Het
Gm35060 G T 18: 32,462,492 probably benign Het
Gm4894 A T 9: 49,278,670 I82L unknown Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gpr176 A C 2: 118,283,904 probably null Het
Gtse1 T C 15: 85,864,180 L262P probably benign Het
Il4ra T C 7: 125,567,221 W46R probably damaging Het
Itga11 A G 9: 62,755,673 Y557C probably benign Het
Kcnab2 A C 4: 152,434,830 probably null Het
Kcnh7 G A 2: 63,184,097 probably benign Het
Ly9 T A 1: 171,601,828 Q230L probably damaging Het
Map2 C A 1: 66,414,884 H978N possibly damaging Het
Map2k6 A G 11: 110,497,906 I225V possibly damaging Het
Map3k13 A G 16: 21,905,245 N326D possibly damaging Het
Mdga2 A G 12: 66,797,763 F85L probably benign Het
Mmp13 C T 9: 7,274,269 P192L probably damaging Het
Mrpl37 T C 4: 107,066,507 T97A probably benign Het
Mycbpap C T 11: 94,513,594 G121D probably benign Het
Nabp1 A G 1: 51,471,385 S153P probably benign Het
Nsun3 A T 16: 62,769,686 F222I probably benign Het
Pcdhga4 A T 18: 37,685,938 D180V probably benign Het
Pex6 C A 17: 46,714,458 probably null Het
Phrf1 C A 7: 141,259,102 probably benign Het
Ppp1r36 A G 12: 76,439,162 T365A possibly damaging Het
Ranbp10 A G 8: 105,773,040 M519T probably benign Het
Rfx4 G A 10: 84,840,017 W32* probably null Het
Ryr1 T C 7: 29,024,241 N4131S probably benign Het
Slc27a6 A G 18: 58,612,234 E580G possibly damaging Het
Slc7a14 T C 3: 31,209,236 D719G probably benign Het
Slfn9 A G 11: 82,987,484 I273T possibly damaging Het
Spice1 A G 16: 44,384,674 E781G probably benign Het
Sspo C T 6: 48,494,176 P4686S possibly damaging Het
Stab1 G T 14: 31,139,551 R2500S probably benign Het
Stox2 A T 8: 47,203,147 M98K possibly damaging Het
Tacc2 T C 7: 130,623,483 S633P probably damaging Het
Tm9sf4 T C 2: 153,195,571 probably null Het
Togaram2 T A 17: 71,704,783 F486I probably damaging Het
Trappc12 A G 12: 28,747,114 S140P possibly damaging Het
Ttc29 A T 8: 78,276,896 N247I probably damaging Het
Uso1 A T 5: 92,192,730 E668D probably benign Het
Vmn2r69 A T 7: 85,411,909 probably null Het
Xirp2 T A 2: 67,511,650 L1412I possibly damaging Het
Xrcc5 T A 1: 72,310,458 D15E probably damaging Het
Zfp661 T C 2: 127,577,048 K391E probably damaging Het
Zfp729b A G 13: 67,593,858 I106T probably benign Het
Zfyve9 A C 4: 108,719,360 S175A probably benign Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50345614 missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50346184 missense probably benign 0.01
IGL02838:Olfr735 APN 14 50345855 missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50346126 missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50345926 missense probably damaging 1.00
R0724:Olfr735 UTSW 14 50345917 missense possibly damaging 0.89
R0839:Olfr735 UTSW 14 50346088 missense probably damaging 0.98
R1766:Olfr735 UTSW 14 50346220 missense probably damaging 1.00
R1799:Olfr735 UTSW 14 50346080 missense probably benign 0.32
R4934:Olfr735 UTSW 14 50345888 missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50345588 missense probably damaging 0.96
R6555:Olfr735 UTSW 14 50345846 nonsense probably null
R6736:Olfr735 UTSW 14 50345448 missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50345828 missense probably benign 0.09
R7922:Olfr735 UTSW 14 50346415 missense probably benign 0.03
R8190:Olfr735 UTSW 14 50345722 missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50345465 missense probably benign 0.06
R8560:Olfr735 UTSW 14 50346337 missense probably benign 0.12
X0019:Olfr735 UTSW 14 50345806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCTTTCACATATGCATGG -3'
(R):5'- CTGATGGTCTCTAACAGTGGC -3'

Sequencing Primer
(F):5'- GGCTTTCACATATGCATGGATTAAAG -3'
(R):5'- AGTGGCATACTGTCTCTTGTC -3'
Posted On 2017-06-26