Incidental Mutation 'R5977:Zcchc7'
ID481172
Institutional Source Beutler Lab
Gene Symbol Zcchc7
Ensembl Gene ENSMUSG00000035649
Gene Namezinc finger, CCHC domain containing 7
SynonymsD4Wsu132e, 4930572I07Rik
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44755877-44932215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44894982 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 236 (V236I)
Ref Sequence ENSEMBL: ENSMUSP00000103454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107824] [ENSMUST00000142714]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067521
Predicted Effect possibly damaging
Transcript: ENSMUST00000107824
AA Change: V236I

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103454
Gene: ENSMUSG00000035649
AA Change: V236I

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
ZnF_C2HC 237 253 4.13e-3 SMART
ZnF_C2HC 259 275 1.51e0 SMART
ZnF_C2HC 300 316 1.08e0 SMART
low complexity region 324 336 N/A INTRINSIC
ZnF_C2HC 344 360 9.16e-2 SMART
low complexity region 497 517 N/A INTRINSIC
low complexity region 530 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142714
SMART Domains Protein: ENSMUSP00000124542
Gene: ENSMUSG00000035649

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144436
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Zcchc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Zcchc7 APN 4 44931318 missense possibly damaging 0.76
IGL00542:Zcchc7 APN 4 44931462 missense probably benign 0.00
IGL01309:Zcchc7 APN 4 44926060 missense probably damaging 1.00
IGL01753:Zcchc7 APN 4 44929217 missense probably benign 0.30
IGL02186:Zcchc7 APN 4 44762250 missense possibly damaging 0.95
IGL02395:Zcchc7 APN 4 44761868 utr 5 prime probably benign
IGL02423:Zcchc7 APN 4 44931244 missense possibly damaging 0.81
IGL03350:Zcchc7 APN 4 44931188 missense probably benign 0.13
R0371:Zcchc7 UTSW 4 44762190 missense probably damaging 1.00
R1449:Zcchc7 UTSW 4 44929124 missense possibly damaging 0.66
R2061:Zcchc7 UTSW 4 44895838 missense probably damaging 1.00
R2096:Zcchc7 UTSW 4 44931059 missense probably damaging 0.98
R4274:Zcchc7 UTSW 4 44931335 missense possibly damaging 0.87
R4668:Zcchc7 UTSW 4 44895964 missense probably damaging 1.00
R4989:Zcchc7 UTSW 4 44931039 missense probably damaging 1.00
R5340:Zcchc7 UTSW 4 44762245 missense probably benign 0.04
R5397:Zcchc7 UTSW 4 44926048 missense probably damaging 0.96
R5700:Zcchc7 UTSW 4 44931084 missense probably benign 0.00
R5891:Zcchc7 UTSW 4 44895838 missense probably damaging 1.00
R5950:Zcchc7 UTSW 4 44931244 missense possibly damaging 0.81
R6005:Zcchc7 UTSW 4 44931218 frame shift probably null
R6405:Zcchc7 UTSW 4 44926032 missense probably damaging 1.00
R7787:Zcchc7 UTSW 4 44895043 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAATAGCGCTATCCCTGCG -3'
(R):5'- GTGTCCAGAGCCACTACATACC -3'

Sequencing Primer
(F):5'- TGTTGTACCAAAGTATTAAAGCTGAC -3'
(R):5'- GCACAGAGTATGACGTATCTGCC -3'
Posted On2017-06-26