Incidental Mutation 'R5977:Uvssa'
ID481177
Institutional Source Beutler Lab
Gene Symbol Uvssa
Ensembl Gene ENSMUSG00000037355
Gene NameUV stimulated scaffold protein A
SynonymsD330017J19Rik, 4933407H18Rik
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location33378549-33419754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33389860 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 257 (K257E)
Ref Sequence ENSEMBL: ENSMUSP00000144025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087864] [ENSMUST00000202046] [ENSMUST00000202816]
Predicted Effect probably damaging
Transcript: ENSMUST00000087864
AA Change: K257E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085170
Gene: ENSMUSG00000037355
AA Change: K257E

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200682
Predicted Effect probably damaging
Transcript: ENSMUST00000202046
AA Change: K257E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144025
Gene: ENSMUSG00000037355
AA Change: K257E

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202816
AA Change: K257E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144400
Gene: ENSMUSG00000037355
AA Change: K257E

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Uvssa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Uvssa APN 5 33408848 missense probably benign 0.00
IGL02136:Uvssa APN 5 33391848 missense probably damaging 1.00
IGL02339:Uvssa APN 5 33414849 missense probably damaging 1.00
IGL03096:Uvssa APN 5 33410924 missense probably benign 0.29
IGL03130:Uvssa APN 5 33391845 missense possibly damaging 0.57
IGL03248:Uvssa APN 5 33391816 missense probably damaging 1.00
PIT1430001:Uvssa UTSW 5 33402570 missense possibly damaging 0.50
PIT4142001:Uvssa UTSW 5 33392084 missense probably benign 0.05
R0326:Uvssa UTSW 5 33408847 missense probably benign 0.01
R0443:Uvssa UTSW 5 33388824 missense possibly damaging 0.68
R1438:Uvssa UTSW 5 33413884 splice site probably benign
R1474:Uvssa UTSW 5 33388821 missense probably benign 0.00
R1521:Uvssa UTSW 5 33413934 missense probably damaging 0.99
R1522:Uvssa UTSW 5 33387808 missense probably damaging 1.00
R1839:Uvssa UTSW 5 33389752 missense probably benign 0.00
R2223:Uvssa UTSW 5 33392063 missense probably damaging 1.00
R3404:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3405:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3406:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3892:Uvssa UTSW 5 33389752 missense probably benign 0.04
R4624:Uvssa UTSW 5 33389956 missense possibly damaging 0.87
R4898:Uvssa UTSW 5 33413913 nonsense probably null
R5413:Uvssa UTSW 5 33410908 missense probably damaging 1.00
R5921:Uvssa UTSW 5 33389752 missense probably benign 0.00
R6198:Uvssa UTSW 5 33409510 missense probably damaging 1.00
R6566:Uvssa UTSW 5 33392176 missense possibly damaging 0.66
R6884:Uvssa UTSW 5 33409117 intron probably null
R8022:Uvssa UTSW 5 33409504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTAAGCTGCTGGTGCC -3'
(R):5'- TTACAGACCTGACGAGAGCAG -3'

Sequencing Primer
(F):5'- GCCCTTGGATTTTGTACCATG -3'
(R):5'- GTTACCTGAGGGGACTTCAACATC -3'
Posted On2017-06-26