Incidental Mutation 'R5977:Relt'
ID481190
Institutional Source Beutler Lab
Gene Symbol Relt
Ensembl Gene ENSMUSG00000008318
Gene NameRELT tumor necrosis factor receptor
SynonymsE430021K24Rik, Tnfrsf19l
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5977 (G1)
Quality Score192.009
Status Not validated
Chromosome7
Chromosomal Location100845847-100863446 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 100863148 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008462] [ENSMUST00000136231] [ENSMUST00000142885] [ENSMUST00000155413]
Predicted Effect probably benign
Transcript: ENSMUST00000008462
SMART Domains Protein: ENSMUSP00000008462
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
low complexity region 132 138 N/A INTRINSIC
Pfam:RELT 170 209 1.8e-21 PFAM
coiled coil region 233 255 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 313 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136231
SMART Domains Protein: ENSMUSP00000121443
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142885
AA Change: V27A
Predicted Effect probably benign
Transcript: ENSMUST00000155413
SMART Domains Protein: ENSMUSP00000118150
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
low complexity region 132 138 N/A INTRINSIC
Pfam:RELT 170 218 1.4e-20 PFAM
low complexity region 285 309 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1 (TRAF1). This receptor is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. Two alternatively spliced transcript variants of this gene encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Relt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Relt APN 7 100851698 missense probably damaging 1.00
IGL01958:Relt APN 7 100851143 missense probably benign 0.16
ANU22:Relt UTSW 7 100851698 missense probably damaging 1.00
P4717OSA:Relt UTSW 7 100847581 missense probably damaging 1.00
R0026:Relt UTSW 7 100850221 nonsense probably null
R0384:Relt UTSW 7 100847505 missense probably benign 0.26
R0437:Relt UTSW 7 100848784 unclassified probably benign
R0626:Relt UTSW 7 100848816 missense probably damaging 1.00
R1582:Relt UTSW 7 100851353 critical splice donor site probably null
R1802:Relt UTSW 7 100850194 missense probably damaging 0.98
R6924:Relt UTSW 7 100847261 missense probably damaging 1.00
R6994:Relt UTSW 7 100853114 splice site probably benign
R7403:Relt UTSW 7 100851448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTCTCTCACATACACAATCAC -3'
(R):5'- TCATTCAAAAGGCGCGCAG -3'

Sequencing Primer
(F):5'- TGGCTGACACCGTTCAGAAC -3'
(R):5'- TGCTCCGAGGAAGTTCT -3'
Posted On2017-06-26