Incidental Mutation 'R5977:Ddx60'
ID481194
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 62021410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000093485]
Predicted Effect probably null
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136121
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 unclassified probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7987:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense not run
Predicted Primers PCR Primer
(F):5'- GCAGGAAAGGTTAGTCTATAGTTGC -3'
(R):5'- TAGACTCACAGAGGGACTTGG -3'

Sequencing Primer
(F):5'- AGTTGCTAGGAAATAAGCATTGC -3'
(R):5'- CTCACAGAGGGACTTGGAGTTAC -3'
Posted On2017-06-26