Incidental Mutation 'R5977:Ddx60'
ID 481194
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 044159-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R5977 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 62474444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably null
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136121
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,451,106 (GRCm39) R446S probably damaging Het
2900092C05Rik A T 7: 12,288,664 (GRCm39) H159L probably benign Het
4933405O20Rik G A 7: 50,249,838 (GRCm39) V291I probably damaging Het
A2ml1 A G 6: 128,558,085 (GRCm39) Y24H probably damaging Het
Adgrv1 C T 13: 81,583,678 (GRCm39) probably null Het
Ankrd52 C T 10: 128,218,566 (GRCm39) H351Y probably damaging Het
Anks6 C A 4: 47,035,748 (GRCm39) A588S probably benign Het
Arl15 T G 13: 114,070,645 (GRCm39) V80G probably damaging Het
Atp8a1 A G 5: 67,904,628 (GRCm39) I532T possibly damaging Het
Birc6 T C 17: 74,910,031 (GRCm39) C1475R probably damaging Het
Carmil1 C T 13: 24,253,719 (GRCm39) R394Q probably damaging Het
Cbfa2t2 T C 2: 154,359,697 (GRCm39) I254T probably damaging Het
Cemip2 A G 19: 21,803,447 (GRCm39) T827A probably benign Het
Col6a3 A G 1: 90,749,571 (GRCm39) V421A possibly damaging Het
Cped1 T C 6: 22,254,607 (GRCm39) V1000A probably damaging Het
Cr1l A T 1: 194,797,076 (GRCm39) Y282* probably null Het
Cryl1 G T 14: 57,620,236 (GRCm39) T43K probably benign Het
Csmd2 C T 4: 127,952,827 (GRCm39) P92L probably damaging Het
Dhrs7b C T 11: 60,743,328 (GRCm39) R187* probably null Het
Dmtf1 T C 5: 9,190,451 (GRCm39) T88A probably damaging Het
Dnah2 T C 11: 69,411,707 (GRCm39) E305G possibly damaging Het
Dscaml1 A C 9: 45,632,596 (GRCm39) N1154T probably benign Het
Efhc1 A G 1: 21,030,442 (GRCm39) Y125C probably damaging Het
Egflam T A 15: 7,347,726 (GRCm39) Y68F possibly damaging Het
Gcm2 A G 13: 41,256,603 (GRCm39) V382A probably damaging Het
Gm18358 A G 7: 84,739,756 (GRCm39) noncoding transcript Het
Gm3443 T G 19: 21,534,960 (GRCm39) I75S probably benign Het
Gpr182 C A 10: 127,586,748 (GRCm39) V68F possibly damaging Het
Herc1 T A 9: 66,340,604 (GRCm39) M1651K possibly damaging Het
Hey1 A T 3: 8,731,418 (GRCm39) probably null Het
Ighv1-43 A C 12: 114,909,829 (GRCm39) V31G probably benign Het
Il17rc T C 6: 113,459,692 (GRCm39) V450A probably damaging Het
Kbtbd4 T G 2: 90,736,487 (GRCm39) V166G probably benign Het
Marveld2 T C 13: 100,748,197 (GRCm39) N294S possibly damaging Het
Mtdh A G 15: 34,099,720 (GRCm39) K61E probably damaging Het
Muc5ac T C 7: 141,350,104 (GRCm39) S616P possibly damaging Het
Myh15 T C 16: 48,973,866 (GRCm39) L1292P probably damaging Het
Nek8 C T 11: 78,058,651 (GRCm39) V550M probably benign Het
Nup155 T A 15: 8,159,721 (GRCm39) probably null Het
Or2y17 G A 11: 49,231,592 (GRCm39) V78M probably damaging Het
Or7c70 A T 10: 78,683,572 (GRCm39) M59K possibly damaging Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Papln G A 12: 83,831,143 (GRCm39) W1099* probably null Het
Pcdhb17 A G 18: 37,618,720 (GRCm39) Y170C probably damaging Het
Pramel12 T C 4: 143,144,229 (GRCm39) Y192H probably benign Het
Prss39 T G 1: 34,541,783 (GRCm39) C287G probably damaging Het
Pyroxd2 A G 19: 42,723,911 (GRCm39) V338A probably damaging Het
Rab19 T A 6: 39,360,860 (GRCm39) F3I probably benign Het
Relt A G 7: 100,512,355 (GRCm39) probably benign Het
Sbf2 T A 7: 109,977,193 (GRCm39) H647L probably benign Het
Scube1 C T 15: 83,513,689 (GRCm39) C327Y probably damaging Het
Sec14l4 A C 11: 3,990,055 (GRCm39) Q118P possibly damaging Het
Shisa9 C G 16: 12,085,292 (GRCm39) D300E probably benign Het
Smg1 A G 7: 117,740,580 (GRCm39) probably benign Het
Sncaip A G 18: 53,002,393 (GRCm39) T305A probably benign Het
Sorcs3 T C 19: 48,784,889 (GRCm39) V1104A probably damaging Het
Ugt1a6b C T 1: 88,143,982 (GRCm39) R201C probably damaging Het
Unc119b A G 5: 115,268,612 (GRCm39) V91A probably benign Het
Uvssa A G 5: 33,547,204 (GRCm39) K257E probably damaging Het
Vmn1r199 A C 13: 22,567,416 (GRCm39) M237L probably benign Het
Vmn1r69 G A 7: 10,314,417 (GRCm39) R26W probably damaging Het
Vmn2r54 A G 7: 12,366,143 (GRCm39) F264L probably damaging Het
Vmn2r7 C T 3: 64,623,464 (GRCm39) W285* probably null Het
Vmn2r78 T A 7: 86,569,541 (GRCm39) S145T possibly damaging Het
Vmn2r78 T A 7: 86,604,115 (GRCm39) N764K probably benign Het
Wdr5b T G 16: 35,862,374 (GRCm39) H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 (GRCm39) V236I possibly damaging Het
Zfp729b G A 13: 67,739,740 (GRCm39) R842C probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,486,527 (GRCm39) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0479:Ddx60 UTSW 8 62,422,691 (GRCm39) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6153:Ddx60 UTSW 8 62,398,974 (GRCm39) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6416:Ddx60 UTSW 8 62,430,984 (GRCm39) missense probably benign 0.00
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8125:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8374:Ddx60 UTSW 8 62,427,205 (GRCm39) missense probably benign 0.01
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAGGAAAGGTTAGTCTATAGTTGC -3'
(R):5'- TAGACTCACAGAGGGACTTGG -3'

Sequencing Primer
(F):5'- AGTTGCTAGGAAATAAGCATTGC -3'
(R):5'- CTCACAGAGGGACTTGGAGTTAC -3'
Posted On 2017-06-26