Mutagenetix > Incidental Mutations

Incidental Mutation 'R5977:Dscaml1'

481196

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

044159-MU

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene?

Possibly non essential (E-score: 0.435) question?

Stock #

R5977 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 45721298 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 1154 (N1154T)

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

Predicted Effect

probably benign
Transcript: ENSMUST00000034592
AA Change: N1154T

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: N1154T

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000216685
AA Change: N183T

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	T	10: 100,615,244	R446S	probably damaging	Het
2900092C05Rik	A	T	7: 12,554,737	H159L	probably benign	Het
4933405O20Rik	G	A	7: 50,600,090	V291I	probably damaging	Het
A2ml1	A	G	6: 128,581,122	Y24H	probably damaging	Het
Adgrv1	C	T	13: 81,435,559		probably null	Het
Ankrd52	C	T	10: 128,382,697	H351Y	probably damaging	Het
Anks6	C	A	4: 47,035,748	A588S	probably benign	Het
Arl15	T	G	13: 113,934,109	V80G	probably damaging	Het
Atp8a1	A	G	5: 67,747,285	I532T	possibly damaging	Het
Birc6	T	C	17: 74,603,036	C1475R	probably damaging	Het
Carmil1	C	T	13: 24,069,736	R394Q	probably damaging	Het
Cbfa2t2	T	C	2: 154,517,777	I254T	probably damaging	Het
Col6a3	A	G	1: 90,821,849	V421A	possibly damaging	Het
Cped1	T	C	6: 22,254,608	V1000A	probably damaging	Het
Cr1l	A	T	1: 195,114,768	Y282*	probably null	Het
Cryl1	G	T	14: 57,382,779	T43K	probably benign	Het
Csmd2	C	T	4: 128,059,034	P92L	probably damaging	Het
Ddx60	G	A	8: 62,021,410		probably null	Het
Dhrs7b	C	T	11: 60,852,502	R187*	probably null	Het
Dmtf1	T	C	5: 9,140,451	T88A	probably damaging	Het
Dnah2	T	C	11: 69,520,881	E305G	possibly damaging	Het
Efhc1	A	G	1: 20,960,218	Y125C	probably damaging	Het
Egflam	T	A	15: 7,318,245	Y68F	possibly damaging	Het
Gcm2	A	G	13: 41,103,127	V382A	probably damaging	Het
Gm18358	A	G	7: 85,090,548		noncoding transcript	Het
Gm3443	T	G	19: 21,557,596	I75S	probably benign	Het
Gpr182	C	A	10: 127,750,879	V68F	possibly damaging	Het
Herc1	T	A	9: 66,433,322	M1651K	possibly damaging	Het
Hey1	A	T	3: 8,666,358		probably null	Het
Ighv1-43	A	C	12: 114,946,209	V31G	probably benign	Het
Il17rc	T	C	6: 113,482,731	V450A	probably damaging	Het
Kbtbd4	T	G	2: 90,906,143	V166G	probably benign	Het
Marveld2	T	C	13: 100,611,689	N294S	possibly damaging	Het
Mtdh	A	G	15: 34,099,574	K61E	probably damaging	Het
Muc5ac	T	C	7: 141,796,367	S616P	possibly damaging	Het
Myh15	T	C	16: 49,153,503	L1292P	probably damaging	Het
Nek8	C	T	11: 78,167,825	V550M	probably benign	Het
Nup155	T	A	15: 8,130,237		probably null	Het
Olfr1356	A	T	10: 78,847,738	M59K	possibly damaging	Het
Olfr1390	G	A	11: 49,340,765	V78M	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Papln	G	A	12: 83,784,369	W1099*	probably null	Het
Pcdhb17	A	G	18: 37,485,667	Y170C	probably damaging	Het
Pramef8	T	C	4: 143,417,659	Y192H	probably benign	Het
Prss39	T	G	1: 34,502,702	C287G	probably damaging	Het
Pyroxd2	A	G	19: 42,735,472	V338A	probably damaging	Het
Rab19	T	A	6: 39,383,926	F3I	probably benign	Het
Relt	A	G	7: 100,863,148		probably benign	Het
Sbf2	T	A	7: 110,377,986	H647L	probably benign	Het
Scube1	C	T	15: 83,629,488	C327Y	probably damaging	Het
Sec14l4	A	C	11: 4,040,055	Q118P	possibly damaging	Het
Shisa9	C	G	16: 12,267,428	D300E	probably benign	Het
Smg1	A	G	7: 118,141,357		probably benign	Het
Sncaip	A	G	18: 52,869,321	T305A	probably benign	Het
Sorcs3	T	C	19: 48,796,450	V1104A	probably damaging	Het
Tmem2	A	G	19: 21,826,083	T827A	probably benign	Het
Ugt1a6b	C	T	1: 88,216,260	R201C	probably damaging	Het
Unc119b	A	G	5: 115,130,553	V91A	probably benign	Het
Uvssa	A	G	5: 33,389,860	K257E	probably damaging	Het
Vmn1r199	A	C	13: 22,383,246	M237L	probably benign	Het
Vmn1r69	G	A	7: 10,580,490	R26W	probably damaging	Het
Vmn2r54	A	G	7: 12,632,216	F264L	probably damaging	Het
Vmn2r7	C	T	3: 64,716,043	W285*	probably null	Het
Vmn2r78	T	A	7: 86,954,907	N764K	probably benign	Het
Vmn2r78	T	A	7: 86,920,333	S145T	possibly damaging	Het
Wdr5b	T	G	16: 36,042,004	H164Q	probably damaging	Het
Zcchc7	G	A	4: 44,894,982	V236I	possibly damaging	Het
Zfp729b	G	A	13: 67,591,621	R842C	probably benign	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R4924:Dscaml1	UTSW	9	45745189	missense	probably damaging	1.00
R5167:Dscaml1	UTSW	9	45717432	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6582:Dscaml1	UTSW	9	45752806	missense	probably benign	0.00
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7286:Dscaml1	UTSW	9	45742746	critical splice donor site	probably null
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7439:Dscaml1	UTSW	9	45710326	missense	possibly damaging	0.94
R7484:Dscaml1	UTSW	9	45749446	splice site	probably null
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
R7979:Dscaml1	UTSW	9	45683731	missense	probably damaging	1.00
R8005:Dscaml1	UTSW	9	45717510	missense	probably damaging	1.00
R8181:Dscaml1	UTSW	9	45746842	missense	possibly damaging	0.86
R8262:Dscaml1	UTSW	9	45747140	intron	probably benign
R8428:Dscaml1	UTSW	9	45742586	missense	probably benign	0.00
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00
Z1177:Dscaml1	UTSW	9	45672791	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAATAGCAGTACAGCTCCCAGAG -3'
(R):5'- CACACTACTGAGAGCTGTCAGC -3'

Sequencing Primer
(F):5'- AGAGCTGCGTCAGACAGTC -3'
(R):5'- TCAGCTCTAATCAGGCCTGGAG -3'

Posted On

2017-06-26