Incidental Mutation 'R5977:Olfr1356'
ID481198
Institutional Source Beutler Lab
Gene Symbol Olfr1356
Ensembl Gene ENSMUSG00000051190
Gene Nameolfactory receptor 1356
SynonymsMOR142-1, MOR142-2_p, GA_x6K02T2QGN0-2962025-2962987
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78845052-78852166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78847738 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 59 (M59K)
Ref Sequence ENSEMBL: ENSMUSP00000144815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061289] [ENSMUST00000205100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061289
AA Change: M59K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054345
Gene: ENSMUSG00000051190
AA Change: M59K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205100
AA Change: M59K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144815
Gene: ENSMUSG00000051190
AA Change: M59K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Olfr1356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Olfr1356 APN 10 78847763 missense probably damaging 1.00
IGL01343:Olfr1356 APN 10 78847597 missense probably damaging 0.97
IGL01576:Olfr1356 APN 10 78847373 missense possibly damaging 0.94
IGL02314:Olfr1356 APN 10 78847265 missense probably damaging 1.00
IGL02474:Olfr1356 APN 10 78847063 missense probably damaging 1.00
IGL02960:Olfr1356 APN 10 78847537 missense probably damaging 1.00
IGL03049:Olfr1356 APN 10 78847522 missense possibly damaging 0.81
IGL03328:Olfr1356 APN 10 78847367 missense probably benign 0.39
R1602:Olfr1356 UTSW 10 78846968 missense probably benign
R1722:Olfr1356 UTSW 10 78846971 missense probably benign
R2178:Olfr1356 UTSW 10 78847778 missense probably damaging 0.96
R3903:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R3904:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R4241:Olfr1356 UTSW 10 78847905 missense probably benign 0.00
R4833:Olfr1356 UTSW 10 78847575 missense probably damaging 1.00
R5465:Olfr1356 UTSW 10 78847018 missense probably benign 0.00
R5527:Olfr1356 UTSW 10 78847775 missense probably benign 0.02
R5606:Olfr1356 UTSW 10 78847561 missense probably benign 0.19
R6219:Olfr1356 UTSW 10 78847259 missense possibly damaging 0.88
R6996:Olfr1356 UTSW 10 78847517 missense probably benign 0.00
R7136:Olfr1356 UTSW 10 78847781 missense probably benign 0.43
R7782:Olfr1356 UTSW 10 78847613 missense probably benign 0.01
R7996:Olfr1356 UTSW 10 78847321 missense not run
Z1176:Olfr1356 UTSW 10 78847021 missense not run
Z1177:Olfr1356 UTSW 10 78847456 missense not run
Predicted Primers PCR Primer
(F):5'- CACATAGTGCAAGGGATGGC -3'
(R):5'- TCCCTGCAGTCCTATGGAAAG -3'

Sequencing Primer
(F):5'- CGGTCATAGGCCATCACTGATAG -3'
(R):5'- CCTGCAGTCCTATGGAAAGAGAAAAC -3'
Posted On2017-06-26