Incidental Mutation 'R5977:Gpr182'
ID481200
Institutional Source Beutler Lab
Gene Symbol Gpr182
Ensembl Gene ENSMUSG00000058396
Gene NameG protein-coupled receptor 182
SynonymsG10-D, NOW, Gpcr22, Admr, Gpcr17, AM-R
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127747276-127751732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127750879 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 68 (V68F)
Ref Sequence ENSEMBL: ENSMUSP00000100882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
Predicted Effect probably benign
Transcript: ENSMUST00000054287
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079692
AA Change: V68F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396
AA Change: V68F

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Gpr182
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Gpr182 APN 10 127750690 missense probably benign 0.09
IGL00983:Gpr182 APN 10 127750788 missense possibly damaging 0.89
IGL01337:Gpr182 APN 10 127750786 missense possibly damaging 0.95
IGL01810:Gpr182 APN 10 127750864 missense probably damaging 1.00
R0449:Gpr182 UTSW 10 127750696 missense probably damaging 1.00
R0554:Gpr182 UTSW 10 127751071 missense probably benign 0.00
R2229:Gpr182 UTSW 10 127750141 missense possibly damaging 0.91
R2292:Gpr182 UTSW 10 127750182 missense possibly damaging 0.89
R2349:Gpr182 UTSW 10 127750937 missense probably damaging 1.00
R2445:Gpr182 UTSW 10 127750627 missense probably benign 0.01
R6290:Gpr182 UTSW 10 127751024 missense probably benign 0.00
R6415:Gpr182 UTSW 10 127750506 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCTGCTGTACATGTTGACAAG -3'
(R):5'- ATGTCAGTCATACCCAGCCC -3'

Sequencing Primer
(F):5'- TAGAAATAATGAATGAAGCGACAGG -3'
(R):5'- CAGGCCCGTCTCCACCTTG -3'
Posted On2017-06-26