Incidental Mutation 'R5977:Wdr5b'
ID481223
Institutional Source Beutler Lab
Gene Symbol Wdr5b
Ensembl Gene ENSMUSG00000034379
Gene NameWD repeat domain 5B
Synonyms
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location36041190-36043928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36042004 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 164 (H164Q)
Ref Sequence ENSEMBL: ENSMUSP00000040852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000004057] [ENSMUST00000042203] [ENSMUST00000231351]
Predicted Effect probably benign
Transcript: ENSMUST00000004054
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000004057
SMART Domains Protein: ENSMUSP00000004057
Gene: ENSMUSG00000003955

DomainStartEndE-ValueType
Pfam:DUF1075 10 155 1.8e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042203
AA Change: H164Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040852
Gene: ENSMUSG00000034379
AA Change: H164Q

DomainStartEndE-ValueType
WD40 28 67 5.95e-7 SMART
WD40 70 109 1.28e-11 SMART
WD40 112 151 4.87e-12 SMART
WD40 154 193 5.22e-12 SMART
WD40 196 236 1.21e-7 SMART
WD40 239 281 5.47e-6 SMART
WD40 284 325 1.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232390
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein containing several WD40 repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, including a trp-asp at the C-terminal end. The encoded protein may mediate protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Zfp729b G A 13: 67,591,621 R842C probably benign Het
Other mutations in Wdr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Wdr5b APN 16 36042263 missense probably damaging 1.00
R0605:Wdr5b UTSW 16 36041996 missense probably benign 0.00
R0627:Wdr5b UTSW 16 36042470 missense probably benign 0.07
R5280:Wdr5b UTSW 16 36041832 missense probably benign 0.16
R6899:Wdr5b UTSW 16 36041780 missense probably damaging 1.00
R7236:Wdr5b UTSW 16 36041838 missense possibly damaging 0.88
R7246:Wdr5b UTSW 16 36041936 missense probably damaging 1.00
R7641:Wdr5b UTSW 16 36042342 missense probably damaging 1.00
R8063:Wdr5b UTSW 16 36041788 missense possibly damaging 0.78
Z1088:Wdr5b UTSW 16 36042443 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTCAGCCTCAGATGATAAGACTC -3'
(R):5'- TGTCCAAAGTTGCAGTGAGAATG -3'

Sequencing Primer
(F):5'- GCCTCAGATGATAAGACTCTAAAGG -3'
(R):5'- GCAGTGAGAATGTATTTACCATTTGG -3'
Posted On2017-06-26