Incidental Mutation 'R5978:Olfr346'
ID481234
Institutional Source Beutler Lab
Gene Symbol Olfr346
Ensembl Gene ENSMUSG00000094764
Gene Nameolfactory receptor 346
SynonymsMOR136-11, GA_x6K02T2NLDC-33382467-33383396
MMRRC Submission 044160-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5978 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36685788-36691293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36688682 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 227 (K227Q)
Ref Sequence ENSEMBL: ENSMUSP00000149916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078854] [ENSMUST00000213258]
Predicted Effect probably benign
Transcript: ENSMUST00000078854
AA Change: K227Q

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077897
Gene: ENSMUSG00000094764
AA Change: K227Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-58 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213258
AA Change: K227Q

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 S218C probably damaging Het
Atp2c2 G A 8: 119,749,875 probably null Het
Ccdc146 T G 5: 21,316,968 I353L probably benign Het
Cst3 A T 2: 148,872,821 M112K probably benign Het
Cst3 T G 2: 148,872,822 M112L probably benign Het
Cyp2j11 A C 4: 96,319,352 L242R probably damaging Het
Eif5b T C 1: 37,998,280 probably null Het
Espl1 A G 15: 102,315,774 I1253M possibly damaging Het
Fstl5 C T 3: 76,145,085 H41Y probably damaging Het
Gm11011 T C 2: 169,584,441 K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Heatr5b C A 17: 78,806,036 V923F probably damaging Het
Hnrnpll G A 17: 80,034,191 T473M probably damaging Het
Iars T A 13: 49,722,993 Y845N probably damaging Het
Il34 T A 8: 110,742,685 D166V probably damaging Het
Kel T A 6: 41,688,045 H595L probably benign Het
Krt77 T C 15: 101,862,928 I313M probably benign Het
Krt84 T C 15: 101,530,230 E274G probably damaging Het
Mctp2 T C 7: 72,090,188 Y818C probably damaging Het
Mrc1 A T 2: 14,315,393 Y1046F probably damaging Het
Myom1 A T 17: 71,117,443 D1429V probably damaging Het
Ncapg2 T C 12: 116,424,671 M325T possibly damaging Het
Nf1 T A 11: 79,540,419 I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 probably null Het
Nlrc5 A T 8: 94,488,593 N940Y probably damaging Het
Nlrp9a T A 7: 26,557,278 I107K probably damaging Het
Ntn5 T C 7: 45,694,013 S328P possibly damaging Het
Parp8 A C 13: 116,895,732 S302A probably benign Het
Ptgr2 G T 12: 84,295,258 E27* probably null Het
Rnf115 T A 3: 96,788,666 I256N probably damaging Het
Ryr3 T A 2: 112,672,269 H3515L probably benign Het
Scel A G 14: 103,529,254 probably null Het
Slc4a5 T A 6: 83,277,536 S572T probably benign Het
Slc4a9 T G 18: 36,535,403 I705S probably damaging Het
Spint4 C T 2: 164,700,332 P101L probably damaging Het
Syt9 T A 7: 107,436,413 D212E probably benign Het
Tmem39a T A 16: 38,591,030 M449K probably benign Het
Ttn T C 2: 76,808,799 T13877A possibly damaging Het
Ube2v2 T C 16: 15,577,127 N20S probably benign Het
Vmn1r14 C T 6: 57,233,944 S169F probably benign Het
Vps13d T C 4: 145,122,611 H2410R probably benign Het
Wdr81 G A 11: 75,444,398 L1781F probably damaging Het
Zfp91 A G 19: 12,770,151 I536T probably benign Het
Other mutations in Olfr346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Olfr346 APN 2 36688538 missense probably damaging 1.00
IGL01770:Olfr346 APN 2 36688105 missense probably benign 0.02
IGL02110:Olfr346 APN 2 36688685 missense probably benign
IGL02212:Olfr346 APN 2 36688182 missense probably damaging 0.98
IGL02346:Olfr346 APN 2 36688004 start codon destroyed probably benign 0.41
IGL02544:Olfr346 APN 2 36688836 missense probably damaging 1.00
IGL02995:Olfr346 APN 2 36688632 missense possibly damaging 0.56
IGL03154:Olfr346 APN 2 36688643 missense possibly damaging 0.78
IGL03389:Olfr346 APN 2 36688262 missense probably benign 0.12
R0100:Olfr346 UTSW 2 36688911 missense probably benign 0.00
R0230:Olfr346 UTSW 2 36688616 missense probably benign 0.01
R1559:Olfr346 UTSW 2 36688758 missense probably damaging 1.00
R1560:Olfr346 UTSW 2 36688143 missense probably damaging 1.00
R1614:Olfr346 UTSW 2 36688309 nonsense probably null
R1697:Olfr346 UTSW 2 36688247 missense probably damaging 1.00
R1738:Olfr346 UTSW 2 36688785 missense probably benign 0.44
R1966:Olfr346 UTSW 2 36688784 missense probably benign 0.01
R2021:Olfr346 UTSW 2 36688475 missense probably benign
R2181:Olfr346 UTSW 2 36688334 missense probably damaging 1.00
R4170:Olfr346 UTSW 2 36688722 missense probably damaging 0.98
R4625:Olfr346 UTSW 2 36688071 missense probably benign 0.06
R5081:Olfr346 UTSW 2 36688643 missense possibly damaging 0.73
R5335:Olfr346 UTSW 2 36688094 missense probably benign
R5966:Olfr346 UTSW 2 36688062 missense probably null 0.00
R6110:Olfr346 UTSW 2 36688547 missense probably benign 0.01
R6329:Olfr346 UTSW 2 36688682 nonsense probably null
R7214:Olfr346 UTSW 2 36688095 missense probably benign 0.35
R7301:Olfr346 UTSW 2 36688011 missense probably benign
R7382:Olfr346 UTSW 2 36688034 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATGCTCTTGTGCACACC -3'
(R):5'- GGGATTCAACATGGGTGTGAC -3'

Sequencing Primer
(F):5'- GGCTCGCCTATCTCACTTTAGAAAC -3'
(R):5'- GTGTGACCACAGTGTACATCATAGC -3'
Posted On2017-06-26