Mutagenetix > Incidental Mutation

Incidental Mutation 'R5978:Anks6'

481244

Institutional Source

Beutler Lab

Gene Symbol

Anks6

Ensembl Gene

ENSMUSG00000066191

Gene Name

ankyrin repeat and sterile alpha motif domain containing 6

Synonyms

b2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6

MMRRC Submission

044160-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5978 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

47015669-47057427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 47049252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 218 (S218C)

Ref Sequence

ENSEMBL: ENSMUSP00000155271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]

AlphaFold

Q6GQX6

Predicted Effect

unknown
Transcript: ENSMUST00000084616
AA Change: S218C

SMART Domains

Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: S218C

Domain	Start	End	E-Value	Type
ANK	8	37	2.39e2	SMART
ANK	68	97	5.62e-4	SMART
ANK	101	130	2.05e-6	SMART
ANK	134	163	1.9e-1	SMART
ANK	181	210	8.99e-3	SMART
ANK	215	244	7.83e-3	SMART
ANK	282	312	5.87e2	SMART
ANK	316	345	1.22e-4	SMART
ANK	350	379	3.57e-6	SMART
ANK	383	414	1.23e3	SMART
low complexity region	539	575	N/A	INTRINSIC
low complexity region	619	673	N/A	INTRINSIC
SAM	700	766	2.73e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107747
AA Change: S218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: S218C

Domain	Start	End	E-Value	Type
ANK	8	37	2.39e2	SMART
ANK	68	97	5.62e-4	SMART
ANK	101	130	2.05e-6	SMART
ANK	134	163	1.9e-1	SMART
ANK	181	210	8.99e-3	SMART
ANK	215	244	7.83e-3	SMART
ANK	282	312	5.87e2	SMART
ANK	316	345	1.22e-4	SMART
ANK	350	379	3.57e-6	SMART
ANK	383	414	1.23e3	SMART
low complexity region	607	643	N/A	INTRINSIC
low complexity region	687	741	N/A	INTRINSIC
low complexity region	748	768	N/A	INTRINSIC
Blast:SAM	769	796	1e-9	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000229609
AA Change: S218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp2c2	G	A	8: 119,749,875		probably null	Het
Ccdc146	T	G	5: 21,316,968	I353L	probably benign	Het
Cst3	A	T	2: 148,872,821	M112K	probably benign	Het
Cst3	T	G	2: 148,872,822	M112L	probably benign	Het
Cyp2j11	A	C	4: 96,319,352	L242R	probably damaging	Het
Eif5b	T	C	1: 37,998,280		probably null	Het
Espl1	A	G	15: 102,315,774	I1253M	possibly damaging	Het
Fstl5	C	T	3: 76,145,085	H41Y	probably damaging	Het
Gm11011	T	C	2: 169,584,441	K84R	unknown	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Heatr5b	C	A	17: 78,806,036	V923F	probably damaging	Het
Hnrnpll	G	A	17: 80,034,191	T473M	probably damaging	Het
Iars	T	A	13: 49,722,993	Y845N	probably damaging	Het
Il34	T	A	8: 110,742,685	D166V	probably damaging	Het
Kel	T	A	6: 41,688,045	H595L	probably benign	Het
Krt77	T	C	15: 101,862,928	I313M	probably benign	Het
Krt84	T	C	15: 101,530,230	E274G	probably damaging	Het
Mctp2	T	C	7: 72,090,188	Y818C	probably damaging	Het
Mrc1	A	T	2: 14,315,393	Y1046F	probably damaging	Het
Myom1	A	T	17: 71,117,443	D1429V	probably damaging	Het
Ncapg2	T	C	12: 116,424,671	M325T	possibly damaging	Het
Nf1	T	A	11: 79,540,419	I1902N	probably damaging	Het
Nkain3	A	T	4: 20,485,026		probably null	Het
Nlrc5	A	T	8: 94,488,593	N940Y	probably damaging	Het
Nlrp9a	T	A	7: 26,557,278	I107K	probably damaging	Het
Ntn5	T	C	7: 45,694,013	S328P	possibly damaging	Het
Olfr346	A	C	2: 36,688,682	K227Q	probably benign	Het
Parp8	A	C	13: 116,895,732	S302A	probably benign	Het
Ptgr2	G	T	12: 84,295,258	E27*	probably null	Het
Rnf115	T	A	3: 96,788,666	I256N	probably damaging	Het
Ryr3	T	A	2: 112,672,269	H3515L	probably benign	Het
Scel	A	G	14: 103,529,254		probably null	Het
Slc4a5	T	A	6: 83,277,536	S572T	probably benign	Het
Slc4a9	T	G	18: 36,535,403	I705S	probably damaging	Het
Spint4	C	T	2: 164,700,332	P101L	probably damaging	Het
Syt9	T	A	7: 107,436,413	D212E	probably benign	Het
Tmem39a	T	A	16: 38,591,030	M449K	probably benign	Het
Ttn	T	C	2: 76,808,799	T13877A	possibly damaging	Het
Ube2v2	T	C	16: 15,577,127	N20S	probably benign	Het
Vmn1r14	C	T	6: 57,233,944	S169F	probably benign	Het
Vps13d	T	C	4: 145,122,611	H2410R	probably benign	Het
Wdr81	G	A	11: 75,444,398	L1781F	probably damaging	Het
Zfp91	A	G	19: 12,770,151	I536T	probably benign	Het

Other mutations in Anks6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Anks6	APN	4	47046054	missense	probably damaging	0.98
IGL01886:Anks6	APN	4	47044850	missense	probably damaging	1.00
IGL02903:Anks6	APN	4	47045004	missense	probably damaging	1.00
PIT4131001:Anks6	UTSW	4	47027109	missense	probably damaging	1.00
R0632:Anks6	UTSW	4	47033167	missense	possibly damaging	0.95
R1220:Anks6	UTSW	4	47025767	splice site	probably benign
R1398:Anks6	UTSW	4	47044926	missense	possibly damaging	0.75
R1479:Anks6	UTSW	4	47044874	missense	probably damaging	1.00
R1519:Anks6	UTSW	4	47027152	missense	probably damaging	0.99
R1713:Anks6	UTSW	4	47039726	missense	probably benign	0.00
R1781:Anks6	UTSW	4	47043639	missense	possibly damaging	0.87
R1853:Anks6	UTSW	4	47049387	missense	probably benign	0.00
R2364:Anks6	UTSW	4	47027248	missense	possibly damaging	0.93
R3790:Anks6	UTSW	4	47049212	missense	probably damaging	0.97
R4432:Anks6	UTSW	4	47044905	nonsense	probably null
R4700:Anks6	UTSW	4	47033127	missense	possibly damaging	0.86
R4847:Anks6	UTSW	4	47033266	missense	probably benign
R4876:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4877:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4878:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4879:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4961:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4962:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4968:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4970:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4971:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5092:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5113:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5389:Anks6	UTSW	4	47038900	splice site	probably benign
R5569:Anks6	UTSW	4	47045007	missense	probably damaging	1.00
R5857:Anks6	UTSW	4	47039736	missense	possibly damaging	0.92
R5977:Anks6	UTSW	4	47035748	missense	probably benign	0.11
R6933:Anks6	UTSW	4	47049164	missense	probably benign	0.25
R7175:Anks6	UTSW	4	47046268	splice site	probably null
R7454:Anks6	UTSW	4	47038919	missense	unknown
R7874:Anks6	UTSW	4	47049275	missense	unknown
R8146:Anks6	UTSW	4	47043605	missense	unknown
R8437:Anks6	UTSW	4	47030705	missense	probably benign	0.00
R9454:Anks6	UTSW	4	47016789	missense	possibly damaging	0.86
R9462:Anks6	UTSW	4	47033142	missense	unknown
R9567:Anks6	UTSW	4	47044880	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTGTAAAGCCACAGCAGGG -3'
(R):5'- TCAATGCTCAGAATCGGCTG -3'

Sequencing Primer
(F):5'- ACCTGTTTTTGGCCTGACAG -3'
(R):5'- AGTGTGCTCACCGTGGCTTC -3'

Posted On

2017-06-26