Incidental Mutation 'R5978:Anks6'
ID481244
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Nameankyrin repeat and sterile alpha motif domain containing 6
Synonymsb2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6
MMRRC Submission 044160-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5978 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location47015669-47057427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47049252 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 218 (S218C)
Ref Sequence ENSEMBL: ENSMUSP00000155271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
Predicted Effect unknown
Transcript: ENSMUST00000084616
AA Change: S218C
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: S218C

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107747
AA Change: S218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: S218C

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229609
AA Change: S218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2c2 G A 8: 119,749,875 probably null Het
Ccdc146 T G 5: 21,316,968 I353L probably benign Het
Cst3 A T 2: 148,872,821 M112K probably benign Het
Cst3 T G 2: 148,872,822 M112L probably benign Het
Cyp2j11 A C 4: 96,319,352 L242R probably damaging Het
Eif5b T C 1: 37,998,280 probably null Het
Espl1 A G 15: 102,315,774 I1253M possibly damaging Het
Fstl5 C T 3: 76,145,085 H41Y probably damaging Het
Gm11011 T C 2: 169,584,441 K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Heatr5b C A 17: 78,806,036 V923F probably damaging Het
Hnrnpll G A 17: 80,034,191 T473M probably damaging Het
Iars T A 13: 49,722,993 Y845N probably damaging Het
Il34 T A 8: 110,742,685 D166V probably damaging Het
Kel T A 6: 41,688,045 H595L probably benign Het
Krt77 T C 15: 101,862,928 I313M probably benign Het
Krt84 T C 15: 101,530,230 E274G probably damaging Het
Mctp2 T C 7: 72,090,188 Y818C probably damaging Het
Mrc1 A T 2: 14,315,393 Y1046F probably damaging Het
Myom1 A T 17: 71,117,443 D1429V probably damaging Het
Ncapg2 T C 12: 116,424,671 M325T possibly damaging Het
Nf1 T A 11: 79,540,419 I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 probably null Het
Nlrc5 A T 8: 94,488,593 N940Y probably damaging Het
Nlrp9a T A 7: 26,557,278 I107K probably damaging Het
Ntn5 T C 7: 45,694,013 S328P possibly damaging Het
Olfr346 A C 2: 36,688,682 K227Q probably benign Het
Parp8 A C 13: 116,895,732 S302A probably benign Het
Ptgr2 G T 12: 84,295,258 E27* probably null Het
Rnf115 T A 3: 96,788,666 I256N probably damaging Het
Ryr3 T A 2: 112,672,269 H3515L probably benign Het
Scel A G 14: 103,529,254 probably null Het
Slc4a5 T A 6: 83,277,536 S572T probably benign Het
Slc4a9 T G 18: 36,535,403 I705S probably damaging Het
Spint4 C T 2: 164,700,332 P101L probably damaging Het
Syt9 T A 7: 107,436,413 D212E probably benign Het
Tmem39a T A 16: 38,591,030 M449K probably benign Het
Ttn T C 2: 76,808,799 T13877A possibly damaging Het
Ube2v2 T C 16: 15,577,127 N20S probably benign Het
Vmn1r14 C T 6: 57,233,944 S169F probably benign Het
Vps13d T C 4: 145,122,611 H2410R probably benign Het
Wdr81 G A 11: 75,444,398 L1781F probably damaging Het
Zfp91 A G 19: 12,770,151 I536T probably benign Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47046054 missense probably damaging 0.98
IGL01886:Anks6 APN 4 47044850 missense probably damaging 1.00
IGL02903:Anks6 APN 4 47045004 missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47027109 missense probably damaging 1.00
R0632:Anks6 UTSW 4 47033167 missense possibly damaging 0.95
R1220:Anks6 UTSW 4 47025767 splice site probably benign
R1398:Anks6 UTSW 4 47044926 missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47044874 missense probably damaging 1.00
R1519:Anks6 UTSW 4 47027152 missense probably damaging 0.99
R1713:Anks6 UTSW 4 47039726 missense probably benign 0.00
R1781:Anks6 UTSW 4 47043639 missense possibly damaging 0.87
R1853:Anks6 UTSW 4 47049387 missense probably benign 0.00
R2364:Anks6 UTSW 4 47027248 missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47049212 missense probably damaging 0.97
R4432:Anks6 UTSW 4 47044905 nonsense probably null
R4700:Anks6 UTSW 4 47033127 missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47033266 missense probably benign
R4876:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4877:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4878:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4879:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4961:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4962:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4968:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4970:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4971:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5092:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5113:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5389:Anks6 UTSW 4 47038900 splice site probably benign
R5569:Anks6 UTSW 4 47045007 missense probably damaging 1.00
R5857:Anks6 UTSW 4 47039736 missense possibly damaging 0.92
R5977:Anks6 UTSW 4 47035748 missense probably benign 0.11
R6933:Anks6 UTSW 4 47049164 missense probably benign 0.25
R7175:Anks6 UTSW 4 47046268 intron probably null
R7454:Anks6 UTSW 4 47038919 missense unknown
R7874:Anks6 UTSW 4 47049275 missense unknown
R7957:Anks6 UTSW 4 47049275 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGTAAAGCCACAGCAGGG -3'
(R):5'- TCAATGCTCAGAATCGGCTG -3'

Sequencing Primer
(F):5'- ACCTGTTTTTGGCCTGACAG -3'
(R):5'- AGTGTGCTCACCGTGGCTTC -3'
Posted On2017-06-26