Mutagenetix > Incidental Mutations

Incidental Mutation 'R5978:Kel'

481248

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

044160-MU

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R5978 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41688045 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 595 (H595L)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]

Predicted Effect

probably benign
Transcript: ENSMUST00000031899
AA Change: H595L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: H595L

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031900

SMART Domains

Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:DUF4717	37	107	7.8e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153760

Predicted Effect

unknown
Transcript: ENSMUST00000192118
AA Change: H277L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192406

Predicted Effect

probably benign
Transcript: ENSMUST00000194597

SMART Domains

Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M13	16	68	3.6e-10	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks6	T	A	4: 47,049,252	S218C	probably damaging	Het
Atp2c2	G	A	8: 119,749,875		probably null	Het
Ccdc146	T	G	5: 21,316,968	I353L	probably benign	Het
Cst3	A	T	2: 148,872,821	M112K	probably benign	Het
Cst3	T	G	2: 148,872,822	M112L	probably benign	Het
Cyp2j11	A	C	4: 96,319,352	L242R	probably damaging	Het
Eif5b	T	C	1: 37,998,280		probably null	Het
Espl1	A	G	15: 102,315,774	I1253M	possibly damaging	Het
Fstl5	C	T	3: 76,145,085	H41Y	probably damaging	Het
Gm11011	T	C	2: 169,584,441	K84R	unknown	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Heatr5b	C	A	17: 78,806,036	V923F	probably damaging	Het
Hnrnpll	G	A	17: 80,034,191	T473M	probably damaging	Het
Iars	T	A	13: 49,722,993	Y845N	probably damaging	Het
Il34	T	A	8: 110,742,685	D166V	probably damaging	Het
Krt77	T	C	15: 101,862,928	I313M	probably benign	Het
Krt84	T	C	15: 101,530,230	E274G	probably damaging	Het
Mctp2	T	C	7: 72,090,188	Y818C	probably damaging	Het
Mrc1	A	T	2: 14,315,393	Y1046F	probably damaging	Het
Myom1	A	T	17: 71,117,443	D1429V	probably damaging	Het
Ncapg2	T	C	12: 116,424,671	M325T	possibly damaging	Het
Nf1	T	A	11: 79,540,419	I1902N	probably damaging	Het
Nkain3	A	T	4: 20,485,026		probably null	Het
Nlrc5	A	T	8: 94,488,593	N940Y	probably damaging	Het
Nlrp9a	T	A	7: 26,557,278	I107K	probably damaging	Het
Ntn5	T	C	7: 45,694,013	S328P	possibly damaging	Het
Olfr346	A	C	2: 36,688,682	K227Q	probably benign	Het
Parp8	A	C	13: 116,895,732	S302A	probably benign	Het
Ptgr2	G	T	12: 84,295,258	E27*	probably null	Het
Rnf115	T	A	3: 96,788,666	I256N	probably damaging	Het
Ryr3	T	A	2: 112,672,269	H3515L	probably benign	Het
Scel	A	G	14: 103,529,254		probably null	Het
Slc4a5	T	A	6: 83,277,536	S572T	probably benign	Het
Slc4a9	T	G	18: 36,535,403	I705S	probably damaging	Het
Spint4	C	T	2: 164,700,332	P101L	probably damaging	Het
Syt9	T	A	7: 107,436,413	D212E	probably benign	Het
Tmem39a	T	A	16: 38,591,030	M449K	probably benign	Het
Ttn	T	C	2: 76,808,799	T13877A	possibly damaging	Het
Ube2v2	T	C	16: 15,577,127	N20S	probably benign	Het
Vmn1r14	C	T	6: 57,233,944	S169F	probably benign	Het
Vps13d	T	C	4: 145,122,611	H2410R	probably benign	Het
Wdr81	G	A	11: 75,444,398	L1781F	probably damaging	Het
Zfp91	A	G	19: 12,770,151	I536T	probably benign	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGCAGAAAGCTATGCAACC -3'
(R):5'- TCATGGCCCATGAATTGTTGC -3'

Sequencing Primer
(F):5'- GAAAGCTATGCAACCACATTTCTG -3'
(R):5'- GGCCCATGAATTGTTGCATATC -3'

Posted On

2017-06-26