Incidental Mutation 'R5978:Ntn5'
ID481252
Institutional Source Beutler Lab
Gene Symbol Ntn5
Ensembl Gene ENSMUSG00000070564
Gene Namenetrin 5
SynonymsLOC243967
MMRRC Submission 044160-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5978 (G1)
Quality Score191.009
Status Not validated
Chromosome7
Chromosomal Location45684022-45694556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45694013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 328 (S328P)
Ref Sequence ENSEMBL: ENSMUSP00000103371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040636] [ENSMUST00000107742] [ENSMUST00000182750] [ENSMUST00000183120]
Predicted Effect probably benign
Transcript: ENSMUST00000040636
SMART Domains Protein: ENSMUSP00000045229
Gene: ENSMUSG00000040364

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 55 362 1.6e-146 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107742
AA Change: S328P

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103371
Gene: ENSMUSG00000070564
AA Change: S328P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
EGF_Lam 173 225 4.1e-2 SMART
EGF_Lam 228 275 1.75e-10 SMART
low complexity region 281 289 N/A INTRINSIC
C345C 313 432 4.71e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182750
AA Change: S259P

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138412
Gene: ENSMUSG00000070564
AA Change: S259P

DomainStartEndE-ValueType
EGF_Lam 41 93 4.1e-2 SMART
EGF_Lam 96 156 3.59e-7 SMART
EGF_Lam 159 206 1.75e-10 SMART
low complexity region 212 220 N/A INTRINSIC
C345C 244 363 4.71e-23 SMART
Predicted Effect silent
Transcript: ENSMUST00000183120
SMART Domains Protein: ENSMUSP00000138144
Gene: ENSMUSG00000070564

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
EGF_Lam 173 225 4.1e-2 SMART
EGF_Lam 228 275 1.75e-10 SMART
low complexity region 281 289 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit ectopic motor neurons that migrate out of the ventral horn and into the motor roots. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 S218C probably damaging Het
Atp2c2 G A 8: 119,749,875 probably null Het
Ccdc146 T G 5: 21,316,968 I353L probably benign Het
Cst3 A T 2: 148,872,821 M112K probably benign Het
Cst3 T G 2: 148,872,822 M112L probably benign Het
Cyp2j11 A C 4: 96,319,352 L242R probably damaging Het
Eif5b T C 1: 37,998,280 probably null Het
Espl1 A G 15: 102,315,774 I1253M possibly damaging Het
Fstl5 C T 3: 76,145,085 H41Y probably damaging Het
Gm11011 T C 2: 169,584,441 K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Heatr5b C A 17: 78,806,036 V923F probably damaging Het
Hnrnpll G A 17: 80,034,191 T473M probably damaging Het
Iars T A 13: 49,722,993 Y845N probably damaging Het
Il34 T A 8: 110,742,685 D166V probably damaging Het
Kel T A 6: 41,688,045 H595L probably benign Het
Krt77 T C 15: 101,862,928 I313M probably benign Het
Krt84 T C 15: 101,530,230 E274G probably damaging Het
Mctp2 T C 7: 72,090,188 Y818C probably damaging Het
Mrc1 A T 2: 14,315,393 Y1046F probably damaging Het
Myom1 A T 17: 71,117,443 D1429V probably damaging Het
Ncapg2 T C 12: 116,424,671 M325T possibly damaging Het
Nf1 T A 11: 79,540,419 I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 probably null Het
Nlrc5 A T 8: 94,488,593 N940Y probably damaging Het
Nlrp9a T A 7: 26,557,278 I107K probably damaging Het
Olfr346 A C 2: 36,688,682 K227Q probably benign Het
Parp8 A C 13: 116,895,732 S302A probably benign Het
Ptgr2 G T 12: 84,295,258 E27* probably null Het
Rnf115 T A 3: 96,788,666 I256N probably damaging Het
Ryr3 T A 2: 112,672,269 H3515L probably benign Het
Scel A G 14: 103,529,254 probably null Het
Slc4a5 T A 6: 83,277,536 S572T probably benign Het
Slc4a9 T G 18: 36,535,403 I705S probably damaging Het
Spint4 C T 2: 164,700,332 P101L probably damaging Het
Syt9 T A 7: 107,436,413 D212E probably benign Het
Tmem39a T A 16: 38,591,030 M449K probably benign Het
Ttn T C 2: 76,808,799 T13877A possibly damaging Het
Ube2v2 T C 16: 15,577,127 N20S probably benign Het
Vmn1r14 C T 6: 57,233,944 S169F probably benign Het
Vps13d T C 4: 145,122,611 H2410R probably benign Het
Wdr81 G A 11: 75,444,398 L1781F probably damaging Het
Zfp91 A G 19: 12,770,151 I536T probably benign Het
Other mutations in Ntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Ntn5 APN 7 45694247 missense probably damaging 1.00
IGL02024:Ntn5 APN 7 45691406 splice site probably benign
IGL02029:Ntn5 APN 7 45686591 missense probably benign 0.00
IGL02302:Ntn5 APN 7 45694248 missense probably damaging 1.00
IGL02676:Ntn5 APN 7 45691876 splice site probably benign
IGL02891:Ntn5 APN 7 45686224 missense probably damaging 0.99
PIT4418001:Ntn5 UTSW 7 45686501 missense probably damaging 0.97
R0179:Ntn5 UTSW 7 45686313 missense probably damaging 0.99
R0594:Ntn5 UTSW 7 45686681 missense probably damaging 0.99
R0755:Ntn5 UTSW 7 45686528 missense probably benign 0.26
R1200:Ntn5 UTSW 7 45692382 missense possibly damaging 0.94
R4779:Ntn5 UTSW 7 45691471 missense probably damaging 1.00
R5974:Ntn5 UTSW 7 45691424 missense probably damaging 1.00
R6189:Ntn5 UTSW 7 45693220 missense probably benign
R6738:Ntn5 UTSW 7 45694356 start gained probably null
R7169:Ntn5 UTSW 7 45686774 nonsense probably null
RF009:Ntn5 UTSW 7 45693260 splice site probably null
Z1088:Ntn5 UTSW 7 45694203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCTTACAAGCACAATCTTG -3'
(R):5'- GCAGGGTCATAGTTGTCGTC -3'

Sequencing Primer
(F):5'- TTTCCCAATGGTCCAAGGAG -3'
(R):5'- CCAGCAGGAGGTAGTCAGC -3'
Posted On2017-06-26