Mutagenetix > Incidental Mutation

Incidental Mutation 'R5978:Nlrc5'

481255

Institutional Source

Beutler Lab

Gene Symbol

Nlrc5

Ensembl Gene

ENSMUSG00000074151

Gene Name

NLR family, CARD domain containing 5

Synonyms

AI451557

MMRRC Submission

044160-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5978 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94434356-94527272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94488593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 940 (N940Y)

Ref Sequence

ENSEMBL: ENSMUSP00000148540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]

AlphaFold

C3VPR6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053085
AA Change: N940Y

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: N940Y

Domain	Start	End	E-Value	Type
low complexity region	136	151	N/A	INTRINSIC
Pfam:NACHT	223	386	1.8e-32	PFAM
LRR	716	743	6.89e1	SMART
LRR	744	771	9.86e1	SMART
LRR	772	796	1.22e2	SMART
LRR	844	870	2.16e2	SMART
LRR	871	898	1.76e-1	SMART
LRR	1006	1033	1.9e0	SMART
LRR	1034	1061	4.51e1	SMART
low complexity region	1141	1169	N/A	INTRINSIC
LRR	1240	1267	2.67e1	SMART
LRR	1273	1295	1.22e1	SMART
low complexity region	1341	1351	N/A	INTRINSIC
LRR	1519	1546	5.48e1	SMART
LRR	1547	1574	3.36e1	SMART
LRR	1575	1602	1.69e1	SMART
LRR	1603	1630	8.99e-1	SMART
LRR	1631	1654	5.26e0	SMART
LRR	1659	1686	2.81e0	SMART
LRR	1687	1714	1.6e-4	SMART
LRR	1715	1742	1.06e0	SMART
LRR	1743	1768	8e0	SMART
LRR	1793	1820	2.06e1	SMART
LRR	1821	1848	5.42e-2	SMART
LRR	1849	1876	3.54e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182409
AA Change: N940Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000183132

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211816
AA Change: N940Y

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks6	T	A	4: 47,049,252	S218C	probably damaging	Het
Atp2c2	G	A	8: 119,749,875		probably null	Het
Ccdc146	T	G	5: 21,316,968	I353L	probably benign	Het
Cst3	A	T	2: 148,872,821	M112K	probably benign	Het
Cst3	T	G	2: 148,872,822	M112L	probably benign	Het
Cyp2j11	A	C	4: 96,319,352	L242R	probably damaging	Het
Eif5b	T	C	1: 37,998,280		probably null	Het
Espl1	A	G	15: 102,315,774	I1253M	possibly damaging	Het
Fstl5	C	T	3: 76,145,085	H41Y	probably damaging	Het
Gm11011	T	C	2: 169,584,441	K84R	unknown	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Heatr5b	C	A	17: 78,806,036	V923F	probably damaging	Het
Hnrnpll	G	A	17: 80,034,191	T473M	probably damaging	Het
Iars	T	A	13: 49,722,993	Y845N	probably damaging	Het
Il34	T	A	8: 110,742,685	D166V	probably damaging	Het
Kel	T	A	6: 41,688,045	H595L	probably benign	Het
Krt77	T	C	15: 101,862,928	I313M	probably benign	Het
Krt84	T	C	15: 101,530,230	E274G	probably damaging	Het
Mctp2	T	C	7: 72,090,188	Y818C	probably damaging	Het
Mrc1	A	T	2: 14,315,393	Y1046F	probably damaging	Het
Myom1	A	T	17: 71,117,443	D1429V	probably damaging	Het
Ncapg2	T	C	12: 116,424,671	M325T	possibly damaging	Het
Nf1	T	A	11: 79,540,419	I1902N	probably damaging	Het
Nkain3	A	T	4: 20,485,026		probably null	Het
Nlrp9a	T	A	7: 26,557,278	I107K	probably damaging	Het
Ntn5	T	C	7: 45,694,013	S328P	possibly damaging	Het
Olfr346	A	C	2: 36,688,682	K227Q	probably benign	Het
Parp8	A	C	13: 116,895,732	S302A	probably benign	Het
Ptgr2	G	T	12: 84,295,258	E27*	probably null	Het
Rnf115	T	A	3: 96,788,666	I256N	probably damaging	Het
Ryr3	T	A	2: 112,672,269	H3515L	probably benign	Het
Scel	A	G	14: 103,529,254		probably null	Het
Slc4a5	T	A	6: 83,277,536	S572T	probably benign	Het
Slc4a9	T	G	18: 36,535,403	I705S	probably damaging	Het
Spint4	C	T	2: 164,700,332	P101L	probably damaging	Het
Syt9	T	A	7: 107,436,413	D212E	probably benign	Het
Tmem39a	T	A	16: 38,591,030	M449K	probably benign	Het
Ttn	T	C	2: 76,808,799	T13877A	possibly damaging	Het
Ube2v2	T	C	16: 15,577,127	N20S	probably benign	Het
Vmn1r14	C	T	6: 57,233,944	S169F	probably benign	Het
Vps13d	T	C	4: 145,122,611	H2410R	probably benign	Het
Wdr81	G	A	11: 75,444,398	L1781F	probably damaging	Het
Zfp91	A	G	19: 12,770,151	I536T	probably benign	Het

Other mutations in Nlrc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Nlrc5	APN	8	94502211	splice site	probably benign
IGL00232:Nlrc5	APN	8	94484623	critical splice donor site	probably null
IGL00324:Nlrc5	APN	8	94521479	missense	probably damaging	1.00
IGL02715:Nlrc5	APN	8	94474668	missense	probably damaging	1.00
IGL02992:Nlrc5	APN	8	94506573	missense	possibly damaging	0.69
IGL03095:Nlrc5	APN	8	94521908	splice site	probably benign
IGL03389:Nlrc5	APN	8	94521474	missense	probably damaging	1.00
IGL03406:Nlrc5	APN	8	94476855	missense	probably benign	0.01
cassis	UTSW	8	94476393	nonsense	probably null
cowberry	UTSW	8	94491525	missense	possibly damaging	0.83
lingon	UTSW	8	94481860	missense	probably damaging	1.00
R0037:Nlrc5	UTSW	8	94489535	missense	probably benign	0.00
R0048:Nlrc5	UTSW	8	94474656	missense	possibly damaging	0.81
R0092:Nlrc5	UTSW	8	94489594	splice site	probably benign
R0506:Nlrc5	UTSW	8	94493125	splice site	probably benign
R0548:Nlrc5	UTSW	8	94521783	missense	probably null	0.09
R2014:Nlrc5	UTSW	8	94525510	splice site	probably benign
R3051:Nlrc5	UTSW	8	94476715	missense	probably benign	0.01
R3776:Nlrc5	UTSW	8	94472839	missense	possibly damaging	0.48
R3837:Nlrc5	UTSW	8	94511301	splice site	probably benign
R4012:Nlrc5	UTSW	8	94475992	missense	possibly damaging	0.92
R4367:Nlrc5	UTSW	8	94476564	missense	probably damaging	1.00
R4400:Nlrc5	UTSW	8	94494353	missense	probably benign	0.08
R4469:Nlrc5	UTSW	8	94520839	missense	probably damaging	1.00
R4561:Nlrc5	UTSW	8	94477146	missense	probably damaging	1.00
R4584:Nlrc5	UTSW	8	94477275	missense	probably damaging	0.96
R4758:Nlrc5	UTSW	8	94512328	missense	possibly damaging	0.70
R4834:Nlrc5	UTSW	8	94505485	missense	probably benign	0.00
R4896:Nlrc5	UTSW	8	94521216	unclassified	probably benign
R5004:Nlrc5	UTSW	8	94521216	unclassified	probably benign
R5018:Nlrc5	UTSW	8	94525452	missense	probably damaging	1.00
R5115:Nlrc5	UTSW	8	94476819	missense	possibly damaging	0.67
R5116:Nlrc5	UTSW	8	94481860	missense	probably damaging	1.00
R5126:Nlrc5	UTSW	8	94474671	missense	possibly damaging	0.95
R5148:Nlrc5	UTSW	8	94476693	missense	probably damaging	1.00
R5224:Nlrc5	UTSW	8	94494316	missense	probably benign	0.26
R5527:Nlrc5	UTSW	8	94490416	missense	probably damaging	1.00
R5640:Nlrc5	UTSW	8	94475793	missense	probably benign	0.02
R5705:Nlrc5	UTSW	8	94475757	missense	probably benign	0.00
R5778:Nlrc5	UTSW	8	94479526	missense	possibly damaging	0.66
R5830:Nlrc5	UTSW	8	94472914	missense	probably damaging	1.00
R5850:Nlrc5	UTSW	8	94521047	missense	probably benign	0.00
R6335:Nlrc5	UTSW	8	94502274	missense	probably benign	0.01
R6372:Nlrc5	UTSW	8	94479750	missense	probably damaging	0.98
R6486:Nlrc5	UTSW	8	94521299	splice site	probably null
R6765:Nlrc5	UTSW	8	94490368	missense	probably benign	0.20
R6861:Nlrc5	UTSW	8	94521229	unclassified	probably benign
R6869:Nlrc5	UTSW	8	94521955	missense	probably benign	0.00
R7134:Nlrc5	UTSW	8	94479722	missense	probably damaging	0.99
R7204:Nlrc5	UTSW	8	94491525	missense	possibly damaging	0.83
R7231:Nlrc5	UTSW	8	94521805	critical splice donor site	probably null
R7309:Nlrc5	UTSW	8	94474042	missense	probably benign	0.01
R7368:Nlrc5	UTSW	8	94476393	nonsense	probably null
R7497:Nlrc5	UTSW	8	94521970	missense	probably damaging	1.00
R7606:Nlrc5	UTSW	8	94477117	missense	possibly damaging	0.67
R7611:Nlrc5	UTSW	8	94512648	critical splice donor site	probably null
R7685:Nlrc5	UTSW	8	94521400	splice site	probably null
R7810:Nlrc5	UTSW	8	94505144	missense	possibly damaging	0.85
R7829:Nlrc5	UTSW	8	94521769	missense	probably damaging	1.00
R7910:Nlrc5	UTSW	8	94493092	missense	probably benign	0.00
R7921:Nlrc5	UTSW	8	94487664	missense	probably damaging	1.00
R8131:Nlrc5	UTSW	8	94481792	missense	probably damaging	1.00
R8237:Nlrc5	UTSW	8	94526125	missense	unknown
R8493:Nlrc5	UTSW	8	94523220	missense	probably damaging	1.00
R8888:Nlrc5	UTSW	8	94525490	missense	probably benign	0.04
R8964:Nlrc5	UTSW	8	94505488	missense	possibly damaging	0.54
R9053:Nlrc5	UTSW	8	94490385	missense	probably benign	0.00
R9058:Nlrc5	UTSW	8	94512310	missense	possibly damaging	0.86
R9161:Nlrc5	UTSW	8	94486646	missense	probably damaging	0.97
R9278:Nlrc5	UTSW	8	94511280	missense	probably benign	0.00
R9285:Nlrc5	UTSW	8	94472976	missense	probably damaging	1.00
R9405:Nlrc5	UTSW	8	94473024	missense	probably damaging	0.98
R9591:Nlrc5	UTSW	8	94522681	missense	probably damaging	1.00
R9620:Nlrc5	UTSW	8	94476406	missense	probably benign	0.44
RF021:Nlrc5	UTSW	8	94476888	missense	probably benign	0.16
Z1088:Nlrc5	UTSW	8	94504464	missense	possibly damaging	0.48
Z1177:Nlrc5	UTSW	8	94506580	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCACGCTGTAAACTGAGAGAC -3'
(R):5'- CTTGTACAGTGTGGGGAAACTG -3'

Sequencing Primer
(F):5'- GCTGTAAACTGAGAGACAAACC -3'
(R):5'- AAACTGAGCCCAGGGTTCCATG -3'

Posted On

2017-06-26