Incidental Mutation 'R5978:Nf1'
ID 481258
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Name neurofibromin 1
Synonyms Mhdadsk9, Dsk9, neurofibromin, Nf-1
MMRRC Submission 044160-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5978 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 79230519-79472438 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79431245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1902 (I1902N)
Ref Sequence ENSEMBL: ENSMUSP00000071289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071325
AA Change: I1902N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: I1902N

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108251
AA Change: I1881N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: I1881N

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146699
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 (GRCm39) S218C probably damaging Het
Atp2c2 G A 8: 120,476,614 (GRCm39) probably null Het
Ccdc146 T G 5: 21,521,966 (GRCm39) I353L probably benign Het
Cst3 A T 2: 148,714,741 (GRCm39) M112K probably benign Het
Cst3 T G 2: 148,714,742 (GRCm39) M112L probably benign Het
Cyp2j11 A C 4: 96,207,589 (GRCm39) L242R probably damaging Het
Eif5b T C 1: 38,037,361 (GRCm39) probably null Het
Espl1 A G 15: 102,224,209 (GRCm39) I1253M possibly damaging Het
Fstl5 C T 3: 76,052,392 (GRCm39) H41Y probably damaging Het
Gm11011 T C 2: 169,426,361 (GRCm39) K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Heatr5b C A 17: 79,113,465 (GRCm39) V923F probably damaging Het
Hnrnpll G A 17: 80,341,620 (GRCm39) T473M probably damaging Het
Iars1 T A 13: 49,876,469 (GRCm39) Y845N probably damaging Het
Il34 T A 8: 111,469,317 (GRCm39) D166V probably damaging Het
Kel T A 6: 41,664,979 (GRCm39) H595L probably benign Het
Krt77 T C 15: 101,771,363 (GRCm39) I313M probably benign Het
Krt84 T C 15: 101,438,665 (GRCm39) E274G probably damaging Het
Mctp2 T C 7: 71,739,936 (GRCm39) Y818C probably damaging Het
Mrc1 A T 2: 14,320,204 (GRCm39) Y1046F probably damaging Het
Myom1 A T 17: 71,424,438 (GRCm39) D1429V probably damaging Het
Ncapg2 T C 12: 116,388,291 (GRCm39) M325T possibly damaging Het
Nkain3 A T 4: 20,485,026 (GRCm39) probably null Het
Nlrc5 A T 8: 95,215,221 (GRCm39) N940Y probably damaging Het
Nlrp9a T A 7: 26,256,703 (GRCm39) I107K probably damaging Het
Ntn5 T C 7: 45,343,437 (GRCm39) S328P possibly damaging Het
Or1j17 A C 2: 36,578,694 (GRCm39) K227Q probably benign Het
Parp8 A C 13: 117,032,268 (GRCm39) S302A probably benign Het
Ptgr2 G T 12: 84,342,032 (GRCm39) E27* probably null Het
Rnf115 T A 3: 96,695,982 (GRCm39) I256N probably damaging Het
Ryr3 T A 2: 112,502,614 (GRCm39) H3515L probably benign Het
Scel A G 14: 103,766,690 (GRCm39) probably null Het
Slc4a5 T A 6: 83,254,518 (GRCm39) S572T probably benign Het
Slc4a9 T G 18: 36,668,456 (GRCm39) I705S probably damaging Het
Spint4 C T 2: 164,542,252 (GRCm39) P101L probably damaging Het
Syt9 T A 7: 107,035,620 (GRCm39) D212E probably benign Het
Tmem39a T A 16: 38,411,392 (GRCm39) M449K probably benign Het
Ttn T C 2: 76,639,143 (GRCm39) T13877A possibly damaging Het
Ube2v2 T C 16: 15,394,991 (GRCm39) N20S probably benign Het
Vmn1r14 C T 6: 57,210,929 (GRCm39) S169F probably benign Het
Vps13d T C 4: 144,849,181 (GRCm39) H2410R probably benign Het
Wdr81 G A 11: 75,335,224 (GRCm39) L1781F probably damaging Het
Zfp91 A G 19: 12,747,515 (GRCm39) I536T probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79,286,731 (GRCm39) missense probably damaging 0.99
IGL00801:Nf1 APN 11 79,319,526 (GRCm39) splice site probably benign
IGL00823:Nf1 APN 11 79,456,343 (GRCm39) missense probably damaging 1.00
IGL00945:Nf1 APN 11 79,360,629 (GRCm39) missense probably damaging 0.99
IGL00960:Nf1 APN 11 79,335,947 (GRCm39) missense probably damaging 1.00
IGL01118:Nf1 APN 11 79,437,812 (GRCm39) missense probably damaging 0.99
IGL01604:Nf1 APN 11 79,332,535 (GRCm39) splice site probably benign
IGL01637:Nf1 APN 11 79,437,946 (GRCm39) missense probably damaging 1.00
IGL01659:Nf1 APN 11 79,450,275 (GRCm39) missense probably benign
IGL01764:Nf1 APN 11 79,275,013 (GRCm39) missense probably benign
IGL01772:Nf1 APN 11 79,281,075 (GRCm39) missense probably damaging 1.00
IGL02047:Nf1 APN 11 79,316,361 (GRCm39) missense probably benign 0.04
IGL02052:Nf1 APN 11 79,303,553 (GRCm39) missense probably damaging 1.00
IGL02071:Nf1 APN 11 79,334,947 (GRCm39) missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79,335,474 (GRCm39) missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79,455,752 (GRCm39) missense probably benign 0.33
IGL02390:Nf1 APN 11 79,456,761 (GRCm39) missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79,302,502 (GRCm39) splice site probably benign
IGL02475:Nf1 APN 11 79,426,493 (GRCm39) missense probably damaging 1.00
IGL02567:Nf1 APN 11 79,437,969 (GRCm39) missense probably damaging 1.00
IGL02571:Nf1 APN 11 79,319,453 (GRCm39) missense probably damaging 1.00
IGL02664:Nf1 APN 11 79,335,424 (GRCm39) critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79,335,425 (GRCm39) critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79,325,759 (GRCm39) splice site probably benign
IGL03006:Nf1 APN 11 79,436,257 (GRCm39) missense probably damaging 1.00
IGL03216:Nf1 APN 11 79,455,721 (GRCm39) missense probably benign 0.17
Diesel UTSW 11 79,447,549 (GRCm39) missense probably damaging 0.96
Eyecandy UTSW 11 79,436,291 (GRCm39) missense probably damaging 1.00
Franklin UTSW 11 79,364,146 (GRCm39) splice site probably null
Gasoline UTSW 11 79,447,615 (GRCm39) missense probably benign 0.17
hancock UTSW 11 79,427,676 (GRCm39) missense probably benign
independence UTSW 11 79,345,136 (GRCm39) intron probably benign
jackson UTSW 11 79,338,398 (GRCm39) missense probably damaging 1.00
Jefferson UTSW 11 79,337,690 (GRCm39) missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79,345,015 (GRCm39) missense probably damaging 1.00
responsibility UTSW 11 79,456,801 (GRCm39) missense probably damaging 0.99
weepy UTSW 11 79,437,812 (GRCm39) missense probably damaging 1.00
C9142:Nf1 UTSW 11 79,447,557 (GRCm39) missense probably damaging 0.98
I2289:Nf1 UTSW 11 79,438,602 (GRCm39) missense probably damaging 1.00
R0055:Nf1 UTSW 11 79,362,377 (GRCm39) missense probably damaging 1.00
R0055:Nf1 UTSW 11 79,362,377 (GRCm39) missense probably damaging 1.00
R0081:Nf1 UTSW 11 79,344,805 (GRCm39) splice site probably benign
R0115:Nf1 UTSW 11 79,359,702 (GRCm39) critical splice donor site probably null
R0144:Nf1 UTSW 11 79,437,953 (GRCm39) missense probably damaging 1.00
R0196:Nf1 UTSW 11 79,469,098 (GRCm39) missense probably damaging 1.00
R0196:Nf1 UTSW 11 79,359,595 (GRCm39) missense possibly damaging 0.94
R0217:Nf1 UTSW 11 79,319,400 (GRCm39) splice site probably benign
R0238:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79,309,400 (GRCm39) missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79,299,525 (GRCm39) splice site probably null
R0362:Nf1 UTSW 11 79,427,704 (GRCm39) missense probably damaging 1.00
R0364:Nf1 UTSW 11 79,332,783 (GRCm39) nonsense probably null
R0464:Nf1 UTSW 11 79,447,615 (GRCm39) missense probably benign 0.17
R0511:Nf1 UTSW 11 79,329,595 (GRCm39) missense probably benign 0.01
R0549:Nf1 UTSW 11 79,359,597 (GRCm39) missense probably damaging 0.99
R0585:Nf1 UTSW 11 79,459,527 (GRCm39) missense probably damaging 0.99
R0636:Nf1 UTSW 11 79,426,529 (GRCm39) missense probably damaging 0.99
R0924:Nf1 UTSW 11 79,344,692 (GRCm39) missense probably damaging 0.98
R0942:Nf1 UTSW 11 79,329,537 (GRCm39) missense probably benign 0.00
R1022:Nf1 UTSW 11 79,437,859 (GRCm39) missense probably damaging 1.00
R1024:Nf1 UTSW 11 79,437,859 (GRCm39) missense probably damaging 1.00
R1350:Nf1 UTSW 11 79,303,513 (GRCm39) missense probably damaging 1.00
R1365:Nf1 UTSW 11 79,438,711 (GRCm39) splice site probably null
R1395:Nf1 UTSW 11 79,426,809 (GRCm39) missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79,319,452 (GRCm39) missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79,319,452 (GRCm39) missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79,286,685 (GRCm39) nonsense probably null
R1508:Nf1 UTSW 11 79,331,735 (GRCm39) missense probably damaging 1.00
R1512:Nf1 UTSW 11 79,281,195 (GRCm39) missense probably damaging 1.00
R1605:Nf1 UTSW 11 79,331,749 (GRCm39) missense probably benign 0.01
R1680:Nf1 UTSW 11 79,441,824 (GRCm39) nonsense probably null
R1704:Nf1 UTSW 11 79,354,127 (GRCm39) splice site probably null
R1707:Nf1 UTSW 11 79,426,430 (GRCm39) missense probably damaging 1.00
R1741:Nf1 UTSW 11 79,334,757 (GRCm39) missense probably benign
R1761:Nf1 UTSW 11 79,275,091 (GRCm39) missense probably damaging 1.00
R1800:Nf1 UTSW 11 79,444,794 (GRCm39) missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79,437,987 (GRCm39) missense probably damaging 1.00
R1966:Nf1 UTSW 11 79,302,390 (GRCm39) missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79,303,571 (GRCm39) missense probably damaging 0.96
R1970:Nf1 UTSW 11 79,444,787 (GRCm39) missense probably benign 0.08
R2059:Nf1 UTSW 11 79,447,549 (GRCm39) missense probably damaging 0.96
R2105:Nf1 UTSW 11 79,360,652 (GRCm39) missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79,338,396 (GRCm39) missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79,334,890 (GRCm39) missense probably benign 0.39
R2497:Nf1 UTSW 11 79,334,710 (GRCm39) missense probably damaging 1.00
R2899:Nf1 UTSW 11 79,303,584 (GRCm39) missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79,437,812 (GRCm39) missense probably damaging 1.00
R3120:Nf1 UTSW 11 79,455,725 (GRCm39) missense probably damaging 0.99
R3744:Nf1 UTSW 11 79,439,573 (GRCm39) missense probably benign 0.23
R3801:Nf1 UTSW 11 79,450,347 (GRCm39) missense probably null 0.98
R3804:Nf1 UTSW 11 79,450,347 (GRCm39) missense probably null 0.98
R4212:Nf1 UTSW 11 79,360,624 (GRCm39) missense probably damaging 1.00
R4298:Nf1 UTSW 11 79,275,070 (GRCm39) missense probably damaging 1.00
R4578:Nf1 UTSW 11 79,336,585 (GRCm39) missense probably damaging 1.00
R4579:Nf1 UTSW 11 79,359,583 (GRCm39) missense probably damaging 1.00
R4587:Nf1 UTSW 11 79,426,863 (GRCm39) critical splice donor site probably null
R4793:Nf1 UTSW 11 79,338,398 (GRCm39) missense probably damaging 1.00
R4834:Nf1 UTSW 11 79,437,123 (GRCm39) missense probably damaging 1.00
R4863:Nf1 UTSW 11 79,300,235 (GRCm39) missense probably damaging 1.00
R4967:Nf1 UTSW 11 79,456,379 (GRCm39) critical splice donor site probably null
R4971:Nf1 UTSW 11 79,335,469 (GRCm39) missense probably damaging 1.00
R5034:Nf1 UTSW 11 79,334,976 (GRCm39) missense probably damaging 0.98
R5036:Nf1 UTSW 11 79,337,690 (GRCm39) missense probably damaging 1.00
R5207:Nf1 UTSW 11 79,345,015 (GRCm39) missense probably damaging 1.00
R5348:Nf1 UTSW 11 79,455,725 (GRCm39) missense probably damaging 1.00
R5356:Nf1 UTSW 11 79,364,282 (GRCm39) missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79,334,785 (GRCm39) missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79,336,615 (GRCm39) missense probably damaging 0.99
R5918:Nf1 UTSW 11 79,460,048 (GRCm39) intron probably benign
R6140:Nf1 UTSW 11 79,364,146 (GRCm39) splice site probably null
R6195:Nf1 UTSW 11 79,456,801 (GRCm39) missense probably damaging 0.99
R6216:Nf1 UTSW 11 79,302,433 (GRCm39) missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79,456,801 (GRCm39) missense probably damaging 0.99
R6257:Nf1 UTSW 11 79,440,317 (GRCm39) missense probably damaging 1.00
R6258:Nf1 UTSW 11 79,456,581 (GRCm39) splice site probably null
R6756:Nf1 UTSW 11 79,335,413 (GRCm39) splice site probably null
R6878:Nf1 UTSW 11 79,325,708 (GRCm39) missense probably damaging 1.00
R6959:Nf1 UTSW 11 79,440,294 (GRCm39) missense probably damaging 0.98
R7007:Nf1 UTSW 11 79,337,849 (GRCm39) splice site probably null
R7066:Nf1 UTSW 11 79,447,546 (GRCm39) missense probably damaging 1.00
R7099:Nf1 UTSW 11 79,461,156 (GRCm39) missense probably benign 0.08
R7213:Nf1 UTSW 11 79,360,645 (GRCm39) missense probably benign 0.23
R7326:Nf1 UTSW 11 79,455,769 (GRCm39) missense probably benign
R7348:Nf1 UTSW 11 79,427,676 (GRCm39) missense probably benign
R7380:Nf1 UTSW 11 79,437,102 (GRCm39) missense probably damaging 1.00
R7407:Nf1 UTSW 11 79,338,969 (GRCm39) missense probably damaging 1.00
R7412:Nf1 UTSW 11 79,364,240 (GRCm39) missense probably damaging 1.00
R7545:Nf1 UTSW 11 79,300,350 (GRCm39) missense probably benign
R7567:Nf1 UTSW 11 79,438,052 (GRCm39) missense probably damaging 0.99
R7574:Nf1 UTSW 11 79,299,595 (GRCm39) missense probably null 0.99
R7616:Nf1 UTSW 11 79,275,092 (GRCm39) missense probably damaging 0.97
R7713:Nf1 UTSW 11 79,316,432 (GRCm39) missense probably benign
R7737:Nf1 UTSW 11 79,436,314 (GRCm39) missense probably benign 0.33
R7869:Nf1 UTSW 11 79,309,414 (GRCm39) missense probably damaging 1.00
R7905:Nf1 UTSW 11 79,437,938 (GRCm39) missense possibly damaging 0.80
R8232:Nf1 UTSW 11 79,469,157 (GRCm39) missense probably damaging 0.96
R8244:Nf1 UTSW 11 79,331,750 (GRCm39) missense probably benign
R8397:Nf1 UTSW 11 79,438,518 (GRCm39) missense probably damaging 1.00
R8436:Nf1 UTSW 11 79,349,709 (GRCm39) missense probably damaging 0.99
R8492:Nf1 UTSW 11 79,299,248 (GRCm39) missense probably benign 0.06
R8719:Nf1 UTSW 11 79,281,119 (GRCm39) missense possibly damaging 0.86
R8735:Nf1 UTSW 11 79,345,136 (GRCm39) intron probably benign
R8795:Nf1 UTSW 11 79,316,442 (GRCm39) missense probably damaging 1.00
R8797:Nf1 UTSW 11 79,366,711 (GRCm39) critical splice donor site probably benign
R8809:Nf1 UTSW 11 79,437,964 (GRCm39) missense probably damaging 0.99
R8812:Nf1 UTSW 11 79,437,180 (GRCm39) missense probably damaging 0.96
R8815:Nf1 UTSW 11 79,332,491 (GRCm39) missense probably damaging 1.00
R8828:Nf1 UTSW 11 79,286,679 (GRCm39) critical splice acceptor site probably null
R8894:Nf1 UTSW 11 79,336,619 (GRCm39) missense probably damaging 1.00
R9051:Nf1 UTSW 11 79,364,168 (GRCm39) missense probably damaging 1.00
R9103:Nf1 UTSW 11 79,450,332 (GRCm39) missense probably damaging 0.99
R9142:Nf1 UTSW 11 79,366,688 (GRCm39) missense probably damaging 1.00
R9142:Nf1 UTSW 11 79,362,315 (GRCm39) missense probably damaging 1.00
R9170:Nf1 UTSW 11 79,436,291 (GRCm39) missense probably damaging 1.00
R9201:Nf1 UTSW 11 79,461,156 (GRCm39) missense probably benign 0.08
R9267:Nf1 UTSW 11 79,331,716 (GRCm39) missense possibly damaging 0.72
R9309:Nf1 UTSW 11 79,359,595 (GRCm39) missense possibly damaging 0.94
R9340:Nf1 UTSW 11 79,447,629 (GRCm39) missense possibly damaging 0.90
R9398:Nf1 UTSW 11 79,438,018 (GRCm39) missense probably damaging 0.99
R9471:Nf1 UTSW 11 79,436,195 (GRCm39) missense probably damaging 0.99
R9630:Nf1 UTSW 11 79,302,470 (GRCm39) missense probably damaging 1.00
R9664:Nf1 UTSW 11 79,334,733 (GRCm39) missense probably damaging 1.00
X0052:Nf1 UTSW 11 79,450,242 (GRCm39) missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79,455,751 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATCGACCGTGCTTTGTG -3'
(R):5'- AAGTGAGAGACTCCTAGTAAATTCCC -3'

Sequencing Primer
(F):5'- CGACCGTGCTTTGTGATAAAACC -3'
(R):5'- TCCTAGTAAATTCCCAAACAAAAGAG -3'
Posted On 2017-06-26