Incidental Mutation 'R5978:Ncapg2'
ID481260
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 044160-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5978 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116424671 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 325 (M325T)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084828
AA Change: M325T

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: M325T

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 S218C probably damaging Het
Atp2c2 G A 8: 119,749,875 probably null Het
Ccdc146 T G 5: 21,316,968 I353L probably benign Het
Cst3 A T 2: 148,872,821 M112K probably benign Het
Cst3 T G 2: 148,872,822 M112L probably benign Het
Cyp2j11 A C 4: 96,319,352 L242R probably damaging Het
Eif5b T C 1: 37,998,280 probably null Het
Espl1 A G 15: 102,315,774 I1253M possibly damaging Het
Fstl5 C T 3: 76,145,085 H41Y probably damaging Het
Gm11011 T C 2: 169,584,441 K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Heatr5b C A 17: 78,806,036 V923F probably damaging Het
Hnrnpll G A 17: 80,034,191 T473M probably damaging Het
Iars T A 13: 49,722,993 Y845N probably damaging Het
Il34 T A 8: 110,742,685 D166V probably damaging Het
Kel T A 6: 41,688,045 H595L probably benign Het
Krt77 T C 15: 101,862,928 I313M probably benign Het
Krt84 T C 15: 101,530,230 E274G probably damaging Het
Mctp2 T C 7: 72,090,188 Y818C probably damaging Het
Mrc1 A T 2: 14,315,393 Y1046F probably damaging Het
Myom1 A T 17: 71,117,443 D1429V probably damaging Het
Nf1 T A 11: 79,540,419 I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 probably null Het
Nlrc5 A T 8: 94,488,593 N940Y probably damaging Het
Nlrp9a T A 7: 26,557,278 I107K probably damaging Het
Ntn5 T C 7: 45,694,013 S328P possibly damaging Het
Olfr346 A C 2: 36,688,682 K227Q probably benign Het
Parp8 A C 13: 116,895,732 S302A probably benign Het
Ptgr2 G T 12: 84,295,258 E27* probably null Het
Rnf115 T A 3: 96,788,666 I256N probably damaging Het
Ryr3 T A 2: 112,672,269 H3515L probably benign Het
Scel A G 14: 103,529,254 probably null Het
Slc4a5 T A 6: 83,277,536 S572T probably benign Het
Slc4a9 T G 18: 36,535,403 I705S probably damaging Het
Spint4 C T 2: 164,700,332 P101L probably damaging Het
Syt9 T A 7: 107,436,413 D212E probably benign Het
Tmem39a T A 16: 38,591,030 M449K probably benign Het
Ttn T C 2: 76,808,799 T13877A possibly damaging Het
Ube2v2 T C 16: 15,577,127 N20S probably benign Het
Vmn1r14 C T 6: 57,233,944 S169F probably benign Het
Vps13d T C 4: 145,122,611 H2410R probably benign Het
Wdr81 G A 11: 75,444,398 L1781F probably damaging Het
Zfp91 A G 19: 12,770,151 I536T probably benign Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGTAGAATAACCTTTCCTCTTG -3'
(R):5'- TTGTGCAAACCAAGACACCG -3'

Sequencing Primer
(F):5'- GAATAACCTTTCCTCTTGTTCCTGAG -3'
(R):5'- GACACCGATTTTCAGTGACTG -3'
Posted On2017-06-26