Incidental Mutation 'R5978:Parp8'
ID 481262
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
MMRRC Submission 044160-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5978 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 116991356-117162073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 117032268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 302 (S302A)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably benign
Transcript: ENSMUST00000022239
AA Change: S302A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: S302A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223949
AA Change: S263A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect unknown
Transcript: ENSMUST00000226107
AA Change: S240R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 (GRCm39) S218C probably damaging Het
Atp2c2 G A 8: 120,476,614 (GRCm39) probably null Het
Ccdc146 T G 5: 21,521,966 (GRCm39) I353L probably benign Het
Cst3 A T 2: 148,714,741 (GRCm39) M112K probably benign Het
Cst3 T G 2: 148,714,742 (GRCm39) M112L probably benign Het
Cyp2j11 A C 4: 96,207,589 (GRCm39) L242R probably damaging Het
Eif5b T C 1: 38,037,361 (GRCm39) probably null Het
Espl1 A G 15: 102,224,209 (GRCm39) I1253M possibly damaging Het
Fstl5 C T 3: 76,052,392 (GRCm39) H41Y probably damaging Het
Gm11011 T C 2: 169,426,361 (GRCm39) K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Heatr5b C A 17: 79,113,465 (GRCm39) V923F probably damaging Het
Hnrnpll G A 17: 80,341,620 (GRCm39) T473M probably damaging Het
Iars1 T A 13: 49,876,469 (GRCm39) Y845N probably damaging Het
Il34 T A 8: 111,469,317 (GRCm39) D166V probably damaging Het
Kel T A 6: 41,664,979 (GRCm39) H595L probably benign Het
Krt77 T C 15: 101,771,363 (GRCm39) I313M probably benign Het
Krt84 T C 15: 101,438,665 (GRCm39) E274G probably damaging Het
Mctp2 T C 7: 71,739,936 (GRCm39) Y818C probably damaging Het
Mrc1 A T 2: 14,320,204 (GRCm39) Y1046F probably damaging Het
Myom1 A T 17: 71,424,438 (GRCm39) D1429V probably damaging Het
Ncapg2 T C 12: 116,388,291 (GRCm39) M325T possibly damaging Het
Nf1 T A 11: 79,431,245 (GRCm39) I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 (GRCm39) probably null Het
Nlrc5 A T 8: 95,215,221 (GRCm39) N940Y probably damaging Het
Nlrp9a T A 7: 26,256,703 (GRCm39) I107K probably damaging Het
Ntn5 T C 7: 45,343,437 (GRCm39) S328P possibly damaging Het
Or1j17 A C 2: 36,578,694 (GRCm39) K227Q probably benign Het
Ptgr2 G T 12: 84,342,032 (GRCm39) E27* probably null Het
Rnf115 T A 3: 96,695,982 (GRCm39) I256N probably damaging Het
Ryr3 T A 2: 112,502,614 (GRCm39) H3515L probably benign Het
Scel A G 14: 103,766,690 (GRCm39) probably null Het
Slc4a5 T A 6: 83,254,518 (GRCm39) S572T probably benign Het
Slc4a9 T G 18: 36,668,456 (GRCm39) I705S probably damaging Het
Spint4 C T 2: 164,542,252 (GRCm39) P101L probably damaging Het
Syt9 T A 7: 107,035,620 (GRCm39) D212E probably benign Het
Tmem39a T A 16: 38,411,392 (GRCm39) M449K probably benign Het
Ttn T C 2: 76,639,143 (GRCm39) T13877A possibly damaging Het
Ube2v2 T C 16: 15,394,991 (GRCm39) N20S probably benign Het
Vmn1r14 C T 6: 57,210,929 (GRCm39) S169F probably benign Het
Vps13d T C 4: 144,849,181 (GRCm39) H2410R probably benign Het
Wdr81 G A 11: 75,335,224 (GRCm39) L1781F probably damaging Het
Zfp91 A G 19: 12,747,515 (GRCm39) I536T probably benign Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 117,063,859 (GRCm39) missense probably damaging 1.00
IGL01346:Parp8 APN 13 117,031,600 (GRCm39) missense possibly damaging 0.72
IGL01793:Parp8 APN 13 117,047,415 (GRCm39) missense probably damaging 1.00
IGL01926:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL01958:Parp8 APN 13 117,013,108 (GRCm39) missense probably benign 0.14
IGL02131:Parp8 APN 13 117,047,409 (GRCm39) missense probably benign 0.08
IGL02398:Parp8 APN 13 117,047,399 (GRCm39) critical splice donor site probably null
IGL02496:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL03135:Parp8 APN 13 117,047,478 (GRCm39) missense probably benign 0.41
IGL03143:Parp8 APN 13 117,047,497 (GRCm39) splice site probably benign
IGL03201:Parp8 APN 13 116,999,605 (GRCm39) splice site probably benign
blondi UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
Heidi UTSW 13 116,998,740 (GRCm39) splice site probably null
R0362:Parp8 UTSW 13 117,061,504 (GRCm39) nonsense probably null
R0699:Parp8 UTSW 13 117,059,120 (GRCm39) missense probably benign 0.01
R1445:Parp8 UTSW 13 117,161,886 (GRCm39) splice site probably null
R1676:Parp8 UTSW 13 117,014,064 (GRCm39) missense probably damaging 0.99
R1977:Parp8 UTSW 13 117,047,449 (GRCm39) missense probably damaging 0.96
R2019:Parp8 UTSW 13 117,004,968 (GRCm39) splice site probably benign
R2049:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2142:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2474:Parp8 UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
R2566:Parp8 UTSW 13 117,032,223 (GRCm39) missense possibly damaging 0.78
R3863:Parp8 UTSW 13 117,031,303 (GRCm39) missense probably benign 0.01
R4126:Parp8 UTSW 13 117,005,005 (GRCm39) missense possibly damaging 0.94
R4518:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4519:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4767:Parp8 UTSW 13 117,005,072 (GRCm39) missense probably damaging 0.99
R5355:Parp8 UTSW 13 116,998,740 (GRCm39) splice site probably null
R5633:Parp8 UTSW 13 117,013,116 (GRCm39) missense probably damaging 1.00
R5942:Parp8 UTSW 13 117,005,969 (GRCm39) missense probably benign 0.12
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6753:Parp8 UTSW 13 117,031,651 (GRCm39) missense possibly damaging 0.91
R7016:Parp8 UTSW 13 117,031,627 (GRCm39) missense probably damaging 1.00
R7139:Parp8 UTSW 13 117,161,802 (GRCm39) missense probably benign 0.21
R7305:Parp8 UTSW 13 117,031,461 (GRCm39) missense possibly damaging 0.95
R7314:Parp8 UTSW 13 117,004,996 (GRCm39) missense probably benign 0.01
R7360:Parp8 UTSW 13 117,032,307 (GRCm39) missense probably benign 0.02
R7526:Parp8 UTSW 13 117,031,341 (GRCm39) missense probably damaging 1.00
R8078:Parp8 UTSW 13 117,061,519 (GRCm39) missense probably damaging 1.00
R8108:Parp8 UTSW 13 117,003,609 (GRCm39) nonsense probably null
R8372:Parp8 UTSW 13 116,991,786 (GRCm39) missense probably damaging 1.00
R9005:Parp8 UTSW 13 117,013,126 (GRCm39) missense probably benign
R9072:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9073:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9351:Parp8 UTSW 13 117,000,781 (GRCm39) missense probably damaging 0.99
R9441:Parp8 UTSW 13 117,029,562 (GRCm39) missense probably damaging 1.00
R9448:Parp8 UTSW 13 117,039,360 (GRCm39) nonsense probably null
R9470:Parp8 UTSW 13 117,031,292 (GRCm39) missense probably benign 0.02
R9562:Parp8 UTSW 13 117,029,631 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTAACTCCGACTTTTCTTGGAAG -3'
(R):5'- GCAGTATATATCTATTGGTGCACAC -3'

Sequencing Primer
(F):5'- ACAAAATAAGTAGCCAGTTAGCAAG -3'
(R):5'- GGGATGGTAGCACACACCTTTAATC -3'
Posted On 2017-06-26