Mutagenetix > Incidental Mutation

Incidental Mutation 'R5978:Hnrnpll'

481270

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpll

Ensembl Gene

ENSMUSG00000024095

Gene Name

heterogeneous nuclear ribonucleoprotein L-like

Synonyms

2510028H02Rik, Hnrpll, 2810036L13Rik

MMRRC Submission

044160-MU

Accession Numbers

Genbank: NM_144802; MGI: 1919942

Essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R5978 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80029487-80062334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80034191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 473 (T473M)

Ref Sequence

ENSEMBL: ENSMUSP00000139372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]

AlphaFold

Q921F4

Predicted Effect

probably damaging
Transcript: ENSMUST00000061331
AA Change: T473M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: T473M

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183516

Predicted Effect

probably benign
Transcript: ENSMUST00000184297

SMART Domains

Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184578

Predicted Effect

probably damaging
Transcript: ENSMUST00000184635
AA Change: T473M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: T473M

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4⁺ T cell counts are lower, with a reduction of naï¿½ve CD44^lo T cells occurring as mice age. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks6	T	A	4: 47,049,252	S218C	probably damaging	Het
Atp2c2	G	A	8: 119,749,875		probably null	Het
Ccdc146	T	G	5: 21,316,968	I353L	probably benign	Het
Cst3	A	T	2: 148,872,821	M112K	probably benign	Het
Cst3	T	G	2: 148,872,822	M112L	probably benign	Het
Cyp2j11	A	C	4: 96,319,352	L242R	probably damaging	Het
Eif5b	T	C	1: 37,998,280		probably null	Het
Espl1	A	G	15: 102,315,774	I1253M	possibly damaging	Het
Fstl5	C	T	3: 76,145,085	H41Y	probably damaging	Het
Gm11011	T	C	2: 169,584,441	K84R	unknown	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Heatr5b	C	A	17: 78,806,036	V923F	probably damaging	Het
Iars	T	A	13: 49,722,993	Y845N	probably damaging	Het
Il34	T	A	8: 110,742,685	D166V	probably damaging	Het
Kel	T	A	6: 41,688,045	H595L	probably benign	Het
Krt77	T	C	15: 101,862,928	I313M	probably benign	Het
Krt84	T	C	15: 101,530,230	E274G	probably damaging	Het
Mctp2	T	C	7: 72,090,188	Y818C	probably damaging	Het
Mrc1	A	T	2: 14,315,393	Y1046F	probably damaging	Het
Myom1	A	T	17: 71,117,443	D1429V	probably damaging	Het
Ncapg2	T	C	12: 116,424,671	M325T	possibly damaging	Het
Nf1	T	A	11: 79,540,419	I1902N	probably damaging	Het
Nkain3	A	T	4: 20,485,026		probably null	Het
Nlrc5	A	T	8: 94,488,593	N940Y	probably damaging	Het
Nlrp9a	T	A	7: 26,557,278	I107K	probably damaging	Het
Ntn5	T	C	7: 45,694,013	S328P	possibly damaging	Het
Olfr346	A	C	2: 36,688,682	K227Q	probably benign	Het
Parp8	A	C	13: 116,895,732	S302A	probably benign	Het
Ptgr2	G	T	12: 84,295,258	E27*	probably null	Het
Rnf115	T	A	3: 96,788,666	I256N	probably damaging	Het
Ryr3	T	A	2: 112,672,269	H3515L	probably benign	Het
Scel	A	G	14: 103,529,254		probably null	Het
Slc4a5	T	A	6: 83,277,536	S572T	probably benign	Het
Slc4a9	T	G	18: 36,535,403	I705S	probably damaging	Het
Spint4	C	T	2: 164,700,332	P101L	probably damaging	Het
Syt9	T	A	7: 107,436,413	D212E	probably benign	Het
Tmem39a	T	A	16: 38,591,030	M449K	probably benign	Het
Ttn	T	C	2: 76,808,799	T13877A	possibly damaging	Het
Ube2v2	T	C	16: 15,577,127	N20S	probably benign	Het
Vmn1r14	C	T	6: 57,233,944	S169F	probably benign	Het
Vps13d	T	C	4: 145,122,611	H2410R	probably benign	Het
Wdr81	G	A	11: 75,444,398	L1781F	probably damaging	Het
Zfp91	A	G	19: 12,770,151	I536T	probably benign	Het

Other mutations in Hnrnpll

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
thunder	APN	17	80053571	missense	probably damaging	1.00
IGL01989:Hnrnpll	APN	17	80038740	missense	probably benign	0.15
IGL02093:Hnrnpll	APN	17	80044504	missense	probably benign	0.00
IGL02141:Hnrnpll	APN	17	80050713	missense	probably benign	0.02
IGL02749:Hnrnpll	APN	17	80061991	start codon destroyed	probably null
IGL03213:Hnrnpll	APN	17	80034098	missense	probably damaging	1.00
Grell	UTSW	17	80034105	missense	probably damaging	1.00
Lindsley	UTSW	17	80049847	missense	probably damaging	1.00
R0477:Hnrnpll	UTSW	17	80061832	missense	unknown
R1599:Hnrnpll	UTSW	17	80053625	missense	unknown
R1700:Hnrnpll	UTSW	17	80034105	missense	probably benign	0.18
R1838:Hnrnpll	UTSW	17	80038623	missense	probably damaging	1.00
R1907:Hnrnpll	UTSW	17	80035329	critical splice donor site	probably null
R1978:Hnrnpll	UTSW	17	80044518	missense	probably benign	0.01
R2079:Hnrnpll	UTSW	17	80035377	missense	probably benign	0.01
R4061:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4062:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4064:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4226:Hnrnpll	UTSW	17	80049805	critical splice donor site	probably null
R4625:Hnrnpll	UTSW	17	80050862	nonsense	probably null
R5175:Hnrnpll	UTSW	17	80034070	missense	possibly damaging	0.83
R5232:Hnrnpll	UTSW	17	80038678	missense	probably damaging	1.00
R5620:Hnrnpll	UTSW	17	80038622	missense	probably damaging	1.00
R6183:Hnrnpll	UTSW	17	80049876	missense	possibly damaging	0.46
R6374:Hnrnpll	UTSW	17	80049874	missense	possibly damaging	0.51
R7120:Hnrnpll	UTSW	17	80034057	missense	probably benign	0.01
R7429:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7430:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7576:Hnrnpll	UTSW	17	80044514	missense	possibly damaging	0.91
R8001:Hnrnpll	UTSW	17	80038723	nonsense	probably null
R8010:Hnrnpll	UTSW	17	80061956	missense	unknown
R8060:Hnrnpll	UTSW	17	80034105	missense	probably damaging	1.00
R8068:Hnrnpll	UTSW	17	80050852	missense	possibly damaging	0.80
R8381:Hnrnpll	UTSW	17	80030491	missense	probably damaging	1.00
R9378:Hnrnpll	UTSW	17	80061862	missense	unknown
R9488:Hnrnpll	UTSW	17	80061956	missense	unknown
Z1177:Hnrnpll	UTSW	17	80048610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAGGCTCTACGTACACAAACC -3'
(R):5'- CCTTGGATAAATGGTTGCCTGC -3'

Sequencing Primer
(F):5'- ATTCTCAAATGAGGCTGAACTATG -3'
(R):5'- GGTTGCCTGCACCAAATTTAAATAGC -3'

Posted On

2017-06-26