Incidental Mutation 'R5979:Prex2'
ID 481274
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Name phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms C030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 11063689-11373905 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11202596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 502 (V502F)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
AlphaFold Q3LAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000027056
AA Change: V502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: V502F

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189822
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11,256,876 (GRCm39) missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11,240,838 (GRCm39) missense probably damaging 0.98
IGL01087:Prex2 APN 1 11,138,328 (GRCm39) missense probably benign 0.00
IGL01490:Prex2 APN 1 11,254,769 (GRCm39) splice site probably null
IGL01533:Prex2 APN 1 11,256,965 (GRCm39) nonsense probably null
IGL01661:Prex2 APN 1 11,278,838 (GRCm39) missense probably benign 0.01
IGL01668:Prex2 APN 1 11,223,869 (GRCm39) missense probably benign 0.00
IGL01674:Prex2 APN 1 11,240,965 (GRCm39) missense probably damaging 1.00
IGL01716:Prex2 APN 1 11,336,278 (GRCm39) missense probably benign 0.04
IGL01867:Prex2 APN 1 11,168,727 (GRCm39) missense probably benign 0.11
IGL01954:Prex2 APN 1 11,210,235 (GRCm39) missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11,193,457 (GRCm39) splice site probably benign
IGL02022:Prex2 APN 1 11,367,963 (GRCm39) missense probably benign 0.04
IGL02130:Prex2 APN 1 11,230,386 (GRCm39) missense probably damaging 1.00
IGL02130:Prex2 APN 1 11,183,023 (GRCm39) missense probably damaging 1.00
IGL02221:Prex2 APN 1 11,131,569 (GRCm39) missense probably benign 0.00
IGL02369:Prex2 APN 1 11,171,393 (GRCm39) critical splice donor site probably null
IGL02440:Prex2 APN 1 11,223,881 (GRCm39) missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11,274,378 (GRCm39) missense probably benign
IGL02492:Prex2 APN 1 11,194,069 (GRCm39) missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11,212,889 (GRCm39) missense probably damaging 1.00
IGL03154:Prex2 APN 1 11,223,857 (GRCm39) missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11,336,291 (GRCm39) missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11,255,399 (GRCm39) missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11,210,489 (GRCm39) missense probably benign 0.01
R0042:Prex2 UTSW 1 11,150,305 (GRCm39) missense probably damaging 1.00
R0052:Prex2 UTSW 1 11,230,380 (GRCm39) missense probably damaging 1.00
R0052:Prex2 UTSW 1 11,230,380 (GRCm39) missense probably damaging 1.00
R0138:Prex2 UTSW 1 11,355,267 (GRCm39) splice site probably benign
R0206:Prex2 UTSW 1 11,355,368 (GRCm39) missense probably damaging 1.00
R0206:Prex2 UTSW 1 11,355,368 (GRCm39) missense probably damaging 1.00
R0208:Prex2 UTSW 1 11,355,368 (GRCm39) missense probably damaging 1.00
R0325:Prex2 UTSW 1 11,270,281 (GRCm39) splice site probably null
R0326:Prex2 UTSW 1 11,355,289 (GRCm39) missense probably damaging 1.00
R0390:Prex2 UTSW 1 11,159,930 (GRCm39) splice site probably null
R0492:Prex2 UTSW 1 11,256,857 (GRCm39) splice site probably benign
R0512:Prex2 UTSW 1 11,270,157 (GRCm39) missense probably benign
R0515:Prex2 UTSW 1 11,270,098 (GRCm39) missense probably damaging 0.99
R0894:Prex2 UTSW 1 11,252,122 (GRCm39) missense probably benign
R1259:Prex2 UTSW 1 11,359,494 (GRCm39) missense probably damaging 1.00
R1332:Prex2 UTSW 1 11,274,315 (GRCm39) missense probably damaging 1.00
R1356:Prex2 UTSW 1 11,150,316 (GRCm39) nonsense probably null
R1451:Prex2 UTSW 1 11,226,483 (GRCm39) missense probably benign 0.01
R1488:Prex2 UTSW 1 11,263,752 (GRCm39) missense probably benign 0.05
R1512:Prex2 UTSW 1 11,131,554 (GRCm39) missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11,301,996 (GRCm39) missense probably damaging 0.99
R1667:Prex2 UTSW 1 11,256,981 (GRCm39) missense probably benign
R1678:Prex2 UTSW 1 11,355,313 (GRCm39) missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11,160,108 (GRCm39) splice site probably benign
R1781:Prex2 UTSW 1 11,270,179 (GRCm39) missense probably benign 0.17
R1804:Prex2 UTSW 1 11,202,566 (GRCm39) missense probably damaging 1.00
R1836:Prex2 UTSW 1 11,207,004 (GRCm39) missense probably damaging 1.00
R1899:Prex2 UTSW 1 11,232,590 (GRCm39) nonsense probably null
R1900:Prex2 UTSW 1 11,232,590 (GRCm39) nonsense probably null
R2020:Prex2 UTSW 1 11,232,536 (GRCm39) missense probably damaging 0.98
R2114:Prex2 UTSW 1 11,256,937 (GRCm39) missense probably damaging 1.00
R2117:Prex2 UTSW 1 11,256,937 (GRCm39) missense probably damaging 1.00
R2436:Prex2 UTSW 1 11,336,376 (GRCm39) missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11,278,838 (GRCm39) missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11,240,077 (GRCm39) missense probably damaging 1.00
R2924:Prex2 UTSW 1 11,168,711 (GRCm39) missense probably damaging 1.00
R2981:Prex2 UTSW 1 11,252,186 (GRCm39) missense probably damaging 1.00
R3430:Prex2 UTSW 1 11,220,078 (GRCm39) missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11,226,588 (GRCm39) splice site probably benign
R3870:Prex2 UTSW 1 11,230,416 (GRCm39) missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11,180,581 (GRCm39) missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11,254,740 (GRCm39) missense probably benign
R4030:Prex2 UTSW 1 11,278,792 (GRCm39) missense probably benign 0.06
R4214:Prex2 UTSW 1 11,171,383 (GRCm39) missense probably damaging 1.00
R4214:Prex2 UTSW 1 11,355,285 (GRCm39) missense probably damaging 1.00
R4242:Prex2 UTSW 1 11,226,528 (GRCm39) missense probably benign 0.06
R4490:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R4491:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R4492:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R4561:Prex2 UTSW 1 11,254,769 (GRCm39) splice site probably null
R4624:Prex2 UTSW 1 11,359,489 (GRCm39) nonsense probably null
R4647:Prex2 UTSW 1 11,232,509 (GRCm39) missense probably damaging 1.00
R4657:Prex2 UTSW 1 11,136,049 (GRCm39) missense probably benign 0.00
R4706:Prex2 UTSW 1 11,270,212 (GRCm39) missense probably damaging 1.00
R4806:Prex2 UTSW 1 11,138,244 (GRCm39) missense probably damaging 1.00
R4900:Prex2 UTSW 1 11,220,129 (GRCm39) splice site probably benign
R4922:Prex2 UTSW 1 11,240,164 (GRCm39) missense probably damaging 1.00
R4961:Prex2 UTSW 1 11,168,705 (GRCm39) missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11,336,314 (GRCm39) nonsense probably null
R5305:Prex2 UTSW 1 11,177,902 (GRCm39) missense probably damaging 1.00
R5307:Prex2 UTSW 1 11,270,256 (GRCm39) missense probably damaging 0.99
R5331:Prex2 UTSW 1 11,210,235 (GRCm39) missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11,210,204 (GRCm39) missense probably damaging 0.99
R5574:Prex2 UTSW 1 11,210,282 (GRCm39) missense probably damaging 1.00
R6076:Prex2 UTSW 1 11,256,174 (GRCm39) missense probably benign 0.09
R6160:Prex2 UTSW 1 11,064,075 (GRCm39) missense probably damaging 1.00
R6177:Prex2 UTSW 1 11,207,001 (GRCm39) missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11,336,236 (GRCm39) missense probably benign 0.01
R6293:Prex2 UTSW 1 11,232,522 (GRCm39) missense probably benign
R6335:Prex2 UTSW 1 11,180,544 (GRCm39) missense probably benign 0.13
R6401:Prex2 UTSW 1 11,256,951 (GRCm39) missense probably benign 0.00
R6427:Prex2 UTSW 1 11,252,255 (GRCm39) missense probably damaging 1.00
R6467:Prex2 UTSW 1 11,336,259 (GRCm39) missense probably damaging 1.00
R6564:Prex2 UTSW 1 11,171,285 (GRCm39) splice site probably null
R6734:Prex2 UTSW 1 11,150,283 (GRCm39) missense probably damaging 1.00
R6753:Prex2 UTSW 1 11,254,680 (GRCm39) missense probably damaging 0.98
R6880:Prex2 UTSW 1 11,202,608 (GRCm39) missense probably damaging 1.00
R6973:Prex2 UTSW 1 11,182,967 (GRCm39) missense probably damaging 1.00
R6980:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R6987:Prex2 UTSW 1 11,240,976 (GRCm39) missense probably damaging 0.99
R7085:Prex2 UTSW 1 11,168,812 (GRCm39) missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11,223,833 (GRCm39) missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11,207,017 (GRCm39) missense probably benign 0.33
R7319:Prex2 UTSW 1 11,232,532 (GRCm39) missense probably benign 0.10
R7342:Prex2 UTSW 1 11,232,549 (GRCm39) missense probably benign 0.00
R7469:Prex2 UTSW 1 11,355,293 (GRCm39) missense probably damaging 1.00
R7528:Prex2 UTSW 1 11,274,316 (GRCm39) missense probably damaging 1.00
R7592:Prex2 UTSW 1 11,193,437 (GRCm39) missense probably damaging 1.00
R7650:Prex2 UTSW 1 11,220,078 (GRCm39) missense possibly damaging 0.67
R7695:Prex2 UTSW 1 11,232,497 (GRCm39) missense probably benign 0.00
R7720:Prex2 UTSW 1 11,252,161 (GRCm39) missense possibly damaging 0.47
R7733:Prex2 UTSW 1 11,252,183 (GRCm39) missense probably benign 0.31
R7859:Prex2 UTSW 1 11,150,274 (GRCm39) missense probably damaging 1.00
R8247:Prex2 UTSW 1 11,270,194 (GRCm39) missense probably benign
R8300:Prex2 UTSW 1 11,301,942 (GRCm39) missense possibly damaging 0.49
R8345:Prex2 UTSW 1 11,270,118 (GRCm39) missense possibly damaging 0.65
R8352:Prex2 UTSW 1 11,355,364 (GRCm39) missense probably benign
R8352:Prex2 UTSW 1 11,355,363 (GRCm39) missense probably benign
R8410:Prex2 UTSW 1 11,223,881 (GRCm39) missense possibly damaging 0.94
R8452:Prex2 UTSW 1 11,355,364 (GRCm39) missense probably benign
R8452:Prex2 UTSW 1 11,355,363 (GRCm39) missense probably benign
R8885:Prex2 UTSW 1 11,240,799 (GRCm39) splice site probably benign
R8926:Prex2 UTSW 1 11,159,930 (GRCm39) splice site probably null
R8968:Prex2 UTSW 1 11,180,562 (GRCm39) nonsense probably null
R9049:Prex2 UTSW 1 11,256,130 (GRCm39) missense probably damaging 0.98
R9398:Prex2 UTSW 1 11,207,028 (GRCm39) missense probably benign 0.00
R9452:Prex2 UTSW 1 11,256,151 (GRCm39) missense probably benign 0.01
R9549:Prex2 UTSW 1 11,256,915 (GRCm39) missense probably damaging 1.00
RF005:Prex2 UTSW 1 11,255,390 (GRCm39) missense possibly damaging 0.47
Z1177:Prex2 UTSW 1 11,359,476 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAAATATACATGCACTGGCTGGC -3'
(R):5'- GTGACTGAACATAGCTATTCTTCAC -3'

Sequencing Primer
(F):5'- CTGAAGGCTCACTGGTAGACTTTC -3'
(R):5'- TGTTTGATGTAACTCAGCTCATG -3'
Posted On 2017-06-26