Incidental Mutation 'R5979:Prex2'
ID481274
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5979 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11132372 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 502 (V502F)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect probably damaging
Transcript: ENSMUST00000027056
AA Change: V502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: V502F

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189822
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1512:Prex2 UTSW 1 11061330 missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1804:Prex2 UTSW 1 11132342 missense probably damaging 1.00
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R1900:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6293:Prex2 UTSW 1 11162298 missense probably benign
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
R7342:Prex2 UTSW 1 11162325 missense probably benign 0.00
R7469:Prex2 UTSW 1 11285069 missense probably damaging 1.00
R7528:Prex2 UTSW 1 11204092 missense probably damaging 1.00
R7592:Prex2 UTSW 1 11123213 missense probably damaging 1.00
R7650:Prex2 UTSW 1 11149854 missense possibly damaging 0.67
R7695:Prex2 UTSW 1 11162273 missense probably benign 0.00
R7720:Prex2 UTSW 1 11181937 missense possibly damaging 0.47
R7733:Prex2 UTSW 1 11181959 missense probably benign 0.31
R7859:Prex2 UTSW 1 11080050 missense probably damaging 1.00
R8247:Prex2 UTSW 1 11199970 missense probably benign
R8300:Prex2 UTSW 1 11231718 missense possibly damaging 0.49
R8345:Prex2 UTSW 1 11199894 missense possibly damaging 0.65
R8352:Prex2 UTSW 1 11285139 missense probably benign
R8352:Prex2 UTSW 1 11285140 missense probably benign
RF005:Prex2 UTSW 1 11185166 missense possibly damaging 0.47
Z1177:Prex2 UTSW 1 11289252 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAAATATACATGCACTGGCTGGC -3'
(R):5'- GTGACTGAACATAGCTATTCTTCAC -3'

Sequencing Primer
(F):5'- CTGAAGGCTCACTGGTAGACTTTC -3'
(R):5'- TGTTTGATGTAACTCAGCTCATG -3'
Posted On2017-06-26