Incidental Mutation 'R5979:Nop58'
ID 481279
Institutional Source Beutler Lab
Gene Symbol Nop58
Ensembl Gene ENSMUSG00000026020
Gene Name NOP58 ribonucleoprotein
Synonyms SIK similar protein, MSSP, Nol5
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 59724134-59750669 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59741990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 173 (D173V)
Ref Sequence ENSEMBL: ENSMUSP00000140250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027174] [ENSMUST00000190265] [ENSMUST00000191142] [ENSMUST00000189327]
AlphaFold Q6DFW4
Predicted Effect probably damaging
Transcript: ENSMUST00000027174
AA Change: D173V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027174
Gene: ENSMUSG00000026020
AA Change: D173V

DomainStartEndE-ValueType
Pfam:NOP5NT 2 66 1.1e-25 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185368
Predicted Effect probably benign
Transcript: ENSMUST00000187491
Predicted Effect probably benign
Transcript: ENSMUST00000187837
Predicted Effect probably damaging
Transcript: ENSMUST00000190265
AA Change: D43V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141100
Gene: ENSMUSG00000026020
AA Change: D43V

DomainStartEndE-ValueType
NOSIC 31 83 2.1e-33 SMART
low complexity region 88 109 N/A INTRINSIC
Pfam:Nop 123 179 5.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191142
AA Change: D173V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140250
Gene: ENSMUSG00000026020
AA Change: D173V

DomainStartEndE-ValueType
Pfam:NOP5NT 1 66 3.2e-26 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
Pfam:Nop 253 401 2.7e-63 PFAM
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189919
AA Change: D98V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190759
Predicted Effect probably benign
Transcript: ENSMUST00000189327
SMART Domains Protein: ENSMUSP00000139517
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
Pfam:NOP5NT 1 60 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188390
Meta Mutation Damage Score 0.9674 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core component of box C/D small nucleolar ribonucleoproteins. Some box C/D small nucleolar RNAs (snoRNAs), such as U3, U8, and U14, are dependent upon the encoded protein for their synthesis. This protein is SUMOylated, which is necessary for high affinity binding to snoRNAs. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Nop58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Nop58 APN 1 59,743,242 (GRCm39) missense probably damaging 0.98
R0584:Nop58 UTSW 1 59,745,919 (GRCm39) missense probably benign 0.00
R1170:Nop58 UTSW 1 59,743,370 (GRCm39) splice site probably benign
R1177:Nop58 UTSW 1 59,740,091 (GRCm39) missense probably damaging 1.00
R1485:Nop58 UTSW 1 59,737,504 (GRCm39) missense probably damaging 0.98
R1588:Nop58 UTSW 1 59,742,031 (GRCm39) missense probably damaging 1.00
R4715:Nop58 UTSW 1 59,735,185 (GRCm39) missense probably benign 0.00
R5611:Nop58 UTSW 1 59,749,672 (GRCm39) unclassified probably benign
R5933:Nop58 UTSW 1 59,743,824 (GRCm39) nonsense probably null
R6010:Nop58 UTSW 1 59,740,071 (GRCm39) missense probably damaging 1.00
R6244:Nop58 UTSW 1 59,742,014 (GRCm39) missense probably damaging 1.00
R6371:Nop58 UTSW 1 59,750,471 (GRCm39) unclassified probably benign
R7210:Nop58 UTSW 1 59,749,539 (GRCm39) splice site probably null
R7337:Nop58 UTSW 1 59,737,599 (GRCm39) missense probably benign 0.00
R7582:Nop58 UTSW 1 59,740,097 (GRCm39) missense probably damaging 0.99
R7704:Nop58 UTSW 1 59,744,754 (GRCm39) missense probably damaging 1.00
R8931:Nop58 UTSW 1 59,731,549 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGCTCCATGGGTAAAG -3'
(R):5'- CAATAATCTTGGCTATCTGGTTCAG -3'

Sequencing Primer
(F):5'- CCATGGGTAAAGGGTATAAGATACTC -3'
(R):5'- AATTTGCATTCGAGGCCAGC -3'
Posted On 2017-06-26