Incidental Mutation 'R5979:Ubr1'
ID 481289
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.833) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120690750-120801196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 120776863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 293 (V293I)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: V293I

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: V293I

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133408
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120,705,888 (GRCm39) missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120,771,574 (GRCm39) missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120,761,353 (GRCm39) missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120,745,386 (GRCm39) missense probably benign
IGL01346:Ubr1 APN 2 120,703,603 (GRCm39) critical splice donor site probably null
IGL01368:Ubr1 APN 2 120,771,612 (GRCm39) splice site probably benign
IGL01539:Ubr1 APN 2 120,756,494 (GRCm39) missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120,764,823 (GRCm39) missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120,705,879 (GRCm39) missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120,751,867 (GRCm39) missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120,730,989 (GRCm39) missense probably benign 0.00
IGL02208:Ubr1 APN 2 120,776,830 (GRCm39) missense probably benign 0.00
IGL02415:Ubr1 APN 2 120,801,084 (GRCm39) utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120,694,854 (GRCm39) missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120,701,460 (GRCm39) splice site probably benign
IGL02627:Ubr1 APN 2 120,771,472 (GRCm39) missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120,745,364 (GRCm39) missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120,771,572 (GRCm39) missense probably benign 0.01
IGL02939:Ubr1 APN 2 120,711,664 (GRCm39) critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120,791,637 (GRCm39) missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120,694,898 (GRCm39) missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120,725,641 (GRCm39) missense probably benign
I1329:Ubr1 UTSW 2 120,764,775 (GRCm39) splice site probably benign
R0022:Ubr1 UTSW 2 120,791,654 (GRCm39) splice site probably benign
R0345:Ubr1 UTSW 2 120,734,584 (GRCm39) splice site probably null
R0373:Ubr1 UTSW 2 120,777,138 (GRCm39) missense probably benign 0.01
R0393:Ubr1 UTSW 2 120,737,427 (GRCm39) missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120,711,574 (GRCm39) missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120,778,364 (GRCm39) nonsense probably null
R0723:Ubr1 UTSW 2 120,711,582 (GRCm39) nonsense probably null
R1178:Ubr1 UTSW 2 120,756,510 (GRCm39) nonsense probably null
R1401:Ubr1 UTSW 2 120,786,125 (GRCm39) missense probably benign 0.01
R1485:Ubr1 UTSW 2 120,791,579 (GRCm39) missense probably benign 0.03
R1572:Ubr1 UTSW 2 120,765,800 (GRCm39) splice site probably benign
R1920:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1921:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1997:Ubr1 UTSW 2 120,776,754 (GRCm39) critical splice donor site probably null
R2129:Ubr1 UTSW 2 120,773,034 (GRCm39) missense probably benign 0.35
R2147:Ubr1 UTSW 2 120,694,811 (GRCm39) missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120,756,528 (GRCm39) missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120,739,963 (GRCm39) missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120,793,929 (GRCm39) missense probably benign 0.02
R3930:Ubr1 UTSW 2 120,746,951 (GRCm39) missense probably benign 0.20
R3979:Ubr1 UTSW 2 120,693,168 (GRCm39) missense probably benign 0.11
R4172:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4173:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4174:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4241:Ubr1 UTSW 2 120,764,867 (GRCm39) missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120,801,084 (GRCm39) utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120,725,547 (GRCm39) splice site probably null
R4449:Ubr1 UTSW 2 120,776,862 (GRCm39) missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120,772,963 (GRCm39) missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120,756,494 (GRCm39) missense probably benign 0.35
R4765:Ubr1 UTSW 2 120,793,923 (GRCm39) nonsense probably null
R4928:Ubr1 UTSW 2 120,745,419 (GRCm39) missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120,794,047 (GRCm39) missense probably benign 0.00
R5033:Ubr1 UTSW 2 120,742,478 (GRCm39) critical splice donor site probably null
R5108:Ubr1 UTSW 2 120,793,903 (GRCm39) missense probably benign 0.20
R5118:Ubr1 UTSW 2 120,712,745 (GRCm39) missense probably benign 0.20
R5211:Ubr1 UTSW 2 120,723,651 (GRCm39) missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120,734,525 (GRCm39) missense probably benign 0.00
R5449:Ubr1 UTSW 2 120,793,981 (GRCm39) missense probably benign
R5452:Ubr1 UTSW 2 120,698,783 (GRCm39) missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120,745,888 (GRCm39) missense probably benign
R5610:Ubr1 UTSW 2 120,722,593 (GRCm39) missense probably benign 0.04
R5637:Ubr1 UTSW 2 120,793,998 (GRCm39) missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120,791,573 (GRCm39) missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120,734,486 (GRCm39) missense probably benign
R6044:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R6146:Ubr1 UTSW 2 120,723,690 (GRCm39) missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120,737,376 (GRCm39) missense probably benign 0.21
R6389:Ubr1 UTSW 2 120,711,520 (GRCm39) missense probably benign 0.03
R6600:Ubr1 UTSW 2 120,745,880 (GRCm39) missense probably benign 0.00
R6670:Ubr1 UTSW 2 120,754,611 (GRCm39) critical splice donor site probably null
R6731:Ubr1 UTSW 2 120,786,121 (GRCm39) missense probably null 0.99
R6836:Ubr1 UTSW 2 120,727,156 (GRCm39) splice site probably null
R6994:Ubr1 UTSW 2 120,794,074 (GRCm39) missense probably benign
R7121:Ubr1 UTSW 2 120,705,979 (GRCm39) missense probably benign 0.00
R7204:Ubr1 UTSW 2 120,734,558 (GRCm39) missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120,693,246 (GRCm39) missense probably benign 0.04
R7434:Ubr1 UTSW 2 120,693,161 (GRCm39) missense probably benign
R7457:Ubr1 UTSW 2 120,748,309 (GRCm39) missense probably benign 0.35
R7464:Ubr1 UTSW 2 120,720,255 (GRCm39) critical splice donor site probably null
R7519:Ubr1 UTSW 2 120,705,925 (GRCm39) missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120,703,672 (GRCm39) missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120,764,855 (GRCm39) missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120,764,898 (GRCm39) nonsense probably null
R8221:Ubr1 UTSW 2 120,791,585 (GRCm39) missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120,793,937 (GRCm39) missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120,741,596 (GRCm39) missense probably benign
R8293:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R8420:Ubr1 UTSW 2 120,701,476 (GRCm39) missense probably benign
R8489:Ubr1 UTSW 2 120,711,548 (GRCm39) missense probably benign 0.42
R8708:Ubr1 UTSW 2 120,696,964 (GRCm39) missense probably benign 0.27
R8856:Ubr1 UTSW 2 120,734,523 (GRCm39) missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120,697,034 (GRCm39) missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120,756,469 (GRCm39) missense probably benign 0.00
R9155:Ubr1 UTSW 2 120,754,615 (GRCm39) missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120,703,603 (GRCm39) critical splice donor site probably null
R9194:Ubr1 UTSW 2 120,778,325 (GRCm39) missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120,727,000 (GRCm39) missense probably benign 0.04
R9401:Ubr1 UTSW 2 120,765,765 (GRCm39) missense probably benign 0.06
R9430:Ubr1 UTSW 2 120,734,506 (GRCm39) missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120,703,627 (GRCm39) missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120,764,820 (GRCm39) missense probably benign 0.06
R9703:Ubr1 UTSW 2 120,732,092 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCCTGGCAAAATATCTG -3'
(R):5'- TTTCTAGGAGCCTAAGTAGAAAAGCC -3'

Sequencing Primer
(F):5'- GGCCTGGCAAAATATCTGTCTAAAG -3'
(R):5'- AAAGCCAAGTGAGGTTATTGTTGCC -3'
Posted On 2017-06-26