Incidental Mutation 'R0514:Acsl6'
ID48129
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Nameacyl-CoA synthetase long-chain family member 6
SynonymsLacsl, Facl6, A330035H04Rik
MMRRC Submission 038708-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.563) question?
Stock #R0514 (G1)
Quality Score85
Status Not validated
Chromosome11
Chromosomal Location54303798-54364756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54350580 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 579 (D579V)
Ref Sequence ENSEMBL: ENSMUSP00000104532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000101213] [ENSMUST00000108904] [ENSMUST00000108905]
Predicted Effect probably damaging
Transcript: ENSMUST00000000145
AA Change: D479V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333
AA Change: D479V

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072178
AA Change: D554V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333
AA Change: D554V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093106
AA Change: D554V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333
AA Change: D554V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094194
AA Change: D554V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333
AA Change: D554V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101211
AA Change: D554V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333
AA Change: D554V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101213
AA Change: D554V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333
AA Change: D554V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108904
AA Change: D579V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333
AA Change: D579V

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108905
AA Change: D579V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333
AA Change: D579V

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127731
Predicted Effect unknown
Transcript: ENSMUST00000139484
AA Change: D43V
SMART Domains Protein: ENSMUSP00000120693
Gene: ENSMUSG00000020333
AA Change: D43V

DomainStartEndE-ValueType
Pfam:AMP-binding 1 53 6.6e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dhx34 T C 7: 16,210,537 Q584R probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dnah5 A G 15: 28,366,321 T2727A probably damaging Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Parg C A 14: 32,254,560 T186K possibly damaging Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Plch2 A G 4: 154,998,886 S431P probably damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Prr5 A G 15: 84,702,766 N248S probably benign Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Tpr A G 1: 150,402,273 K117E possibly damaging Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54325646 missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54338419 missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54323305 missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54352997 missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54350559 missense probably benign 0.04
IGL01775:Acsl6 APN 11 54346000 splice site probably benign
IGL02487:Acsl6 APN 11 54336943 missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54327276 missense probably benign 0.02
IGL02893:Acsl6 APN 11 54345899 missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54337135 missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54323308 missense probably damaging 1.00
R1611:Acsl6 UTSW 11 54325564 missense possibly damaging 0.93
R1626:Acsl6 UTSW 11 54352046 missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54328398 splice site probably benign
R1697:Acsl6 UTSW 11 54329966 missense probably damaging 1.00
R1852:Acsl6 UTSW 11 54361076 missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54325591 missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54320259 missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54341778 missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54327157 missense probably benign 0.03
R2205:Acsl6 UTSW 11 54324007 missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54327280 missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54337086 missense probably benign 0.19
R4450:Acsl6 UTSW 11 54328403 missense probably damaging 1.00
R4783:Acsl6 UTSW 11 54336993 missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54340498 unclassified probably null
R5233:Acsl6 UTSW 11 54325606 missense possibly damaging 0.69
R5416:Acsl6 UTSW 11 54337171 missense probably benign 0.00
R5482:Acsl6 UTSW 11 54327138 missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54337189 missense probably benign
R5749:Acsl6 UTSW 11 54324055 critical splice donor site probably null
R6139:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54352107 missense probably benign 0.45
R6337:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54325564 missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54325166 missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54341756 splice site probably null
R6919:Acsl6 UTSW 11 54341756 splice site probably null
R7846:Acsl6 UTSW 11 54361075 missense probably damaging 0.98
R7910:Acsl6 UTSW 11 54345971 nonsense probably null
R7929:Acsl6 UTSW 11 54361075 missense probably damaging 0.98
R7991:Acsl6 UTSW 11 54345971 nonsense probably null
Z1177:Acsl6 UTSW 11 54320172 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATCTGAGCACAGGCACTGAATG -3'
(R):5'- AACGCAATCTGGAGGTTCTGGAGG -3'

Sequencing Primer
(F):5'- GTCTGCTTTgggggggg -3'
(R):5'- TCTGGAGGGCCGGTATG -3'
Posted On2013-06-12