Incidental Mutation 'R5979:Smox'
ID 481290
Institutional Source Beutler Lab
Gene Symbol Smox
Ensembl Gene ENSMUSG00000027333
Gene Name spermine oxidase
Synonyms SMO, B130066H01Rik
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.358) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 131333624-131367103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 131358334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 136 (V136I)
Ref Sequence ENSEMBL: ENSMUSP00000139278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028806] [ENSMUST00000110179] [ENSMUST00000110180] [ENSMUST00000110181] [ENSMUST00000110182] [ENSMUST00000110183] [ENSMUST00000129143] [ENSMUST00000110186] [ENSMUST00000110188] [ENSMUST00000110189] [ENSMUST00000183947] [ENSMUST00000131698] [ENSMUST00000183575]
AlphaFold Q99K82
Predicted Effect probably damaging
Transcript: ENSMUST00000028806
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028806
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 7.2e-8 PFAM
Pfam:DAO 26 194 2.5e-9 PFAM
Pfam:NAD_binding_8 29 96 3.8e-18 PFAM
Pfam:Amino_oxidase 34 275 4.2e-27 PFAM
Pfam:Amino_oxidase 302 544 3.4e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110179
AA Change: V136I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105808
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 206 4.2e-10 PFAM
Pfam:Pyr_redox_3 28 101 2.3e-8 PFAM
Pfam:NAD_binding_8 29 96 1e-18 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110180
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105809
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 5e-8 PFAM
Pfam:DAO 26 196 1.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.5e-18 PFAM
Pfam:Amino_oxidase 34 272 2.2e-27 PFAM
Pfam:Amino_oxidase 277 408 3.8e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110181
AA Change: V136I
SMART Domains Protein: ENSMUSP00000105810
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 3.6e-8 PFAM
Pfam:DAO 26 202 8.9e-10 PFAM
Pfam:NAD_binding_8 29 96 1.2e-18 PFAM
Pfam:Amino_oxidase 34 116 2.1e-22 PFAM
Pfam:Amino_oxidase 197 374 1.3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110182
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105811
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.2e-6 PFAM
Pfam:FAD_binding_2 26 87 1.6e-8 PFAM
Pfam:DAO 26 183 2.9e-9 PFAM
Pfam:Pyr_redox_3 28 103 1.4e-8 PFAM
Pfam:NAD_binding_8 29 96 6.3e-19 PFAM
Pfam:Amino_oxidase 34 118 3.6e-23 PFAM
Pfam:Amino_oxidase 129 179 1.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110183
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105812
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 2.3e-8 PFAM
Pfam:DAO 26 227 5.1e-10 PFAM
Pfam:Pyr_redox_3 28 103 2.2e-8 PFAM
Pfam:NAD_binding_8 29 96 1.1e-18 PFAM
Pfam:Amino_oxidase 34 118 6.2e-23 PFAM
Pfam:Amino_oxidase 141 237 4.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129143
AA Change: V136I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120237
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 9.3e-7 PFAM
Pfam:FAD_binding_2 26 86 8.9e-9 PFAM
Pfam:DAO 26 190 1.6e-10 PFAM
Pfam:Pyr_redox_3 28 102 9.5e-9 PFAM
Pfam:NAD_binding_8 29 96 2.7e-19 PFAM
Pfam:Amino_oxidase 34 118 6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110186
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105815
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 78 1.7e-7 PFAM
Pfam:DAO 26 132 7.9e-9 PFAM
Pfam:NAD_binding_8 29 95 5.6e-18 PFAM
Pfam:Amino_oxidase 34 275 2.9e-28 PFAM
Pfam:Amino_oxidase 304 574 2.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110188
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105817
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.9e-8 PFAM
Pfam:DAO 26 194 2.4e-9 PFAM
Pfam:NAD_binding_8 29 96 3.6e-18 PFAM
Pfam:Amino_oxidase 34 275 3.8e-27 PFAM
Pfam:Amino_oxidase 302 463 2.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110189
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105818
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_2 26 85 6.5e-8 PFAM
Pfam:DAO 26 194 2.2e-9 PFAM
Pfam:NAD_binding_8 29 96 3.4e-18 PFAM
Pfam:Amino_oxidase 34 275 3.5e-27 PFAM
Pfam:Amino_oxidase 302 462 5.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183947
AA Change: V136I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139278
Gene: ENSMUSG00000027333
AA Change: V136I

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 79 1.4e-6 PFAM
Pfam:FAD_binding_2 26 85 1.8e-8 PFAM
Pfam:DAO 26 200 5e-10 PFAM
Pfam:Pyr_redox_3 28 102 1.7e-8 PFAM
Pfam:NAD_binding_8 29 96 7.7e-19 PFAM
Pfam:Amino_oxidase 34 118 4.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151627
Predicted Effect probably benign
Transcript: ENSMUST00000183881
Predicted Effect probably benign
Transcript: ENSMUST00000131698
SMART Domains Protein: ENSMUSP00000114956
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:FAD_binding_3 24 56 1.1e-6 PFAM
Pfam:DAO 26 56 8.1e-9 PFAM
Pfam:FAD_binding_2 26 56 2.9e-8 PFAM
Pfam:NAD_binding_8 29 56 6.5e-9 PFAM
Pfam:Amino_oxidase 34 56 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183575
SMART Domains Protein: ENSMUSP00000139099
Gene: ENSMUSG00000027333

DomainStartEndE-ValueType
Pfam:Thi4 17 73 8.6e-7 PFAM
Pfam:FAD_binding_2 26 75 3.3e-9 PFAM
Pfam:DAO 26 79 4.2e-10 PFAM
Pfam:Pyr_redox 26 79 1.4e-7 PFAM
Pfam:Pyr_redox_3 28 77 2.1e-9 PFAM
Pfam:NAD_binding_8 29 80 6.8e-15 PFAM
Pfam:Amino_oxidase 34 76 3.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Smox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Smox APN 2 131,353,979 (GRCm39) missense possibly damaging 0.91
IGL02022:Smox APN 2 131,362,037 (GRCm39) missense probably damaging 0.98
R0368:Smox UTSW 2 131,364,078 (GRCm39) missense probably damaging 1.00
R0411:Smox UTSW 2 131,362,564 (GRCm39) missense probably benign 0.02
R1416:Smox UTSW 2 131,364,051 (GRCm39) missense probably damaging 1.00
R1601:Smox UTSW 2 131,362,094 (GRCm39) missense probably damaging 1.00
R1959:Smox UTSW 2 131,362,384 (GRCm39) missense probably damaging 0.97
R2173:Smox UTSW 2 131,353,944 (GRCm39) missense possibly damaging 0.91
R2215:Smox UTSW 2 131,362,190 (GRCm39) critical splice donor site probably null
R4179:Smox UTSW 2 131,366,770 (GRCm39) missense possibly damaging 0.84
R5282:Smox UTSW 2 131,363,026 (GRCm39) missense probably damaging 0.99
R5630:Smox UTSW 2 131,366,786 (GRCm39) nonsense probably null
R6984:Smox UTSW 2 131,364,031 (GRCm39) missense possibly damaging 0.90
R6986:Smox UTSW 2 131,364,031 (GRCm39) missense possibly damaging 0.90
R7073:Smox UTSW 2 131,364,031 (GRCm39) missense possibly damaging 0.90
R7074:Smox UTSW 2 131,364,031 (GRCm39) missense possibly damaging 0.90
R7183:Smox UTSW 2 131,362,486 (GRCm39) missense possibly damaging 0.91
R8054:Smox UTSW 2 131,364,100 (GRCm39) missense probably benign 0.01
R9222:Smox UTSW 2 131,362,843 (GRCm39) missense possibly damaging 0.65
X0026:Smox UTSW 2 131,358,155 (GRCm39) missense probably damaging 1.00
Z1176:Smox UTSW 2 131,362,461 (GRCm39) missense probably damaging 0.98
Z1177:Smox UTSW 2 131,354,006 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTCTCTTGTCACTACCAG -3'
(R):5'- CATGAATCCCCACACTGTCCTG -3'

Sequencing Primer
(F):5'- GGTCTCTTGTCACTACCAGGAGAC -3'
(R):5'- ACACTGTCCTGATGCTCACTCAG -3'
Posted On 2017-06-26