Incidental Mutation 'R5979:Rbm12'
ID 481292
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene Name RNA binding motif protein 12
Synonyms SWAN, 9430070C08Rik, 5730420G12Rik
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155933876-155953847 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to C at 155939679 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000131377] [ENSMUST00000132494] [ENSMUST00000153634] [ENSMUST00000138068] [ENSMUST00000136296] [ENSMUST00000147627] [ENSMUST00000154889] [ENSMUST00000133921] [ENSMUST00000142960] [ENSMUST00000128499] [ENSMUST00000184265] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184899]
AlphaFold Q8R4X3
Predicted Effect unknown
Transcript: ENSMUST00000059647
AA Change: S198A
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824
AA Change: S198A

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109604
AA Change: S198A
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824
AA Change: S198A

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127956
AA Change: S109A
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950
AA Change: S109A

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131377
AA Change: S198A
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824
AA Change: S198A

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132494
AA Change: S198A
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950
AA Change: S198A

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 155,937,961 (GRCm39) intron probably benign
IGL01307:Rbm12 APN 2 155,937,302 (GRCm39) intron probably benign
IGL02474:Rbm12 APN 2 155,940,017 (GRCm39) missense probably damaging 1.00
IGL02596:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02601:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02603:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02608:Rbm12 APN 2 155,937,818 (GRCm39) intron probably benign
IGL02679:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02691:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02693:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02702:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL02703:Rbm12 APN 2 155,937,480 (GRCm39) intron probably benign
IGL03407:Rbm12 APN 2 155,939,484 (GRCm39) nonsense probably null
IGL02991:Rbm12 UTSW 2 155,937,480 (GRCm39) intron probably benign
R0310:Rbm12 UTSW 2 155,937,644 (GRCm39) intron probably benign
R1213:Rbm12 UTSW 2 155,939,412 (GRCm39) nonsense probably null
R1280:Rbm12 UTSW 2 155,938,749 (GRCm39) missense probably damaging 1.00
R1511:Rbm12 UTSW 2 155,939,456 (GRCm39) missense probably damaging 0.98
R1951:Rbm12 UTSW 2 155,939,133 (GRCm39) missense probably damaging 0.99
R2131:Rbm12 UTSW 2 155,937,430 (GRCm39) nonsense probably null
R2133:Rbm12 UTSW 2 155,937,430 (GRCm39) nonsense probably null
R2883:Rbm12 UTSW 2 155,938,995 (GRCm39) missense probably damaging 0.98
R4760:Rbm12 UTSW 2 155,939,048 (GRCm39) missense probably damaging 0.99
R4783:Rbm12 UTSW 2 155,938,484 (GRCm39) missense possibly damaging 0.95
R4784:Rbm12 UTSW 2 155,938,484 (GRCm39) missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 155,938,484 (GRCm39) missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 155,937,489 (GRCm39) intron probably benign
R5057:Rbm12 UTSW 2 155,938,806 (GRCm39) missense probably benign 0.18
R5383:Rbm12 UTSW 2 155,945,285 (GRCm39) utr 5 prime probably benign
R5599:Rbm12 UTSW 2 155,938,713 (GRCm39) nonsense probably null
R6083:Rbm12 UTSW 2 155,939,646 (GRCm39) intron probably benign
R6769:Rbm12 UTSW 2 155,939,375 (GRCm39) missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 155,939,375 (GRCm39) missense possibly damaging 0.95
R7233:Rbm12 UTSW 2 155,937,894 (GRCm39) missense unknown
R7424:Rbm12 UTSW 2 155,939,223 (GRCm39) missense possibly damaging 0.57
R7483:Rbm12 UTSW 2 155,940,138 (GRCm39) missense unknown
R7643:Rbm12 UTSW 2 155,940,137 (GRCm39) missense unknown
R7848:Rbm12 UTSW 2 155,938,136 (GRCm39) missense probably benign 0.01
R8556:Rbm12 UTSW 2 155,938,481 (GRCm39) missense probably damaging 1.00
R8866:Rbm12 UTSW 2 155,938,693 (GRCm39) nonsense probably null
R8875:Rbm12 UTSW 2 155,938,841 (GRCm39) missense probably damaging 1.00
R9054:Rbm12 UTSW 2 155,937,481 (GRCm39) missense unknown
R9115:Rbm12 UTSW 2 155,938,030 (GRCm39) intron probably benign
R9179:Rbm12 UTSW 2 155,938,463 (GRCm39) missense probably benign 0.05
R9262:Rbm12 UTSW 2 155,939,317 (GRCm39) missense possibly damaging 0.49
R9495:Rbm12 UTSW 2 155,939,738 (GRCm39) missense unknown
R9656:Rbm12 UTSW 2 155,940,121 (GRCm39) missense unknown
R9701:Rbm12 UTSW 2 155,938,166 (GRCm39) missense probably benign 0.01
R9759:Rbm12 UTSW 2 155,938,546 (GRCm39) missense probably benign 0.03
RF001:Rbm12 UTSW 2 155,937,995 (GRCm39) intron probably benign
RF021:Rbm12 UTSW 2 155,938,026 (GRCm39) intron probably benign
RF028:Rbm12 UTSW 2 155,938,050 (GRCm39) frame shift probably null
RF029:Rbm12 UTSW 2 155,938,015 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,002 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,000 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,937,999 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,004 (GRCm39) intron probably benign
RF033:Rbm12 UTSW 2 155,938,003 (GRCm39) intron probably benign
RF038:Rbm12 UTSW 2 155,938,026 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGAGCCATTCATTCCAGC -3'
(R):5'- GCCAAGTGTAGTAACTGCTACCAC -3'

Sequencing Primer
(F):5'- CCATTCATTCCAGCAGGTAAAGGTG -3'
(R):5'- CACTTCTGTTCATGAGAGCAAC -3'
Posted On 2017-06-26