Incidental Mutation 'R5979:Igsf10'
ID 481296
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Name immunoglobulin superfamily, member 10
Synonyms 6530405F15Rik, CMF608, Adlican2
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 59224156-59251815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59243894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 147 (E147K)
Ref Sequence ENSEMBL: ENSMUSP00000141391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546] [ENSMUST00000195983]
AlphaFold Q3V1M1
Predicted Effect probably damaging
Transcript: ENSMUST00000039419
AA Change: E147K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: E147K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193455
AA Change: E147K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: E147K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194546
AA Change: E147K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: E147K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195983
SMART Domains Protein: ENSMUSP00000143071
Gene: ENSMUSG00000036334

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 1.5e-6 SMART
Meta Mutation Damage Score 0.2203 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59,238,960 (GRCm39) missense probably benign 0.03
IGL00790:Igsf10 APN 3 59,226,938 (GRCm39) missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59,238,548 (GRCm39) missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59,238,018 (GRCm39) missense probably benign 0.00
IGL01066:Igsf10 APN 3 59,235,203 (GRCm39) critical splice donor site probably null
IGL01107:Igsf10 APN 3 59,238,945 (GRCm39) missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59,227,071 (GRCm39) missense probably benign 0.02
IGL01533:Igsf10 APN 3 59,226,651 (GRCm39) missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59,237,452 (GRCm39) missense probably benign 0.00
IGL01676:Igsf10 APN 3 59,236,756 (GRCm39) missense probably benign 0.17
IGL01676:Igsf10 APN 3 59,233,432 (GRCm39) missense probably benign 0.06
IGL01960:Igsf10 APN 3 59,226,158 (GRCm39) missense probably benign 0.00
IGL02123:Igsf10 APN 3 59,226,081 (GRCm39) missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59,233,399 (GRCm39) missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59,238,573 (GRCm39) nonsense probably null
IGL02313:Igsf10 APN 3 59,238,111 (GRCm39) missense probably benign 0.01
IGL02368:Igsf10 APN 3 59,235,652 (GRCm39) missense probably benign
IGL02494:Igsf10 APN 3 59,235,427 (GRCm39) missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59,236,662 (GRCm39) missense probably benign 0.03
IGL02616:Igsf10 APN 3 59,226,027 (GRCm39) missense probably benign 0.06
IGL02957:Igsf10 APN 3 59,238,285 (GRCm39) missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59,226,339 (GRCm39) missense probably benign 0.25
IGL03104:Igsf10 APN 3 59,226,905 (GRCm39) missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59,227,086 (GRCm39) missense probably benign 0.01
IGL03212:Igsf10 APN 3 59,235,586 (GRCm39) missense probably benign 0.09
IGL03347:Igsf10 APN 3 59,239,321 (GRCm39) missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59,243,632 (GRCm39) missense probably benign 0.35
F6893:Igsf10 UTSW 3 59,238,481 (GRCm39) missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59,226,531 (GRCm39) missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59,235,579 (GRCm39) missense probably benign 0.06
PIT4402001:Igsf10 UTSW 3 59,233,000 (GRCm39) missense probably benign 0.00
PIT4810001:Igsf10 UTSW 3 59,225,903 (GRCm39) missense probably damaging 1.00
R0068:Igsf10 UTSW 3 59,238,045 (GRCm39) missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59,238,617 (GRCm39) nonsense probably null
R0095:Igsf10 UTSW 3 59,238,617 (GRCm39) nonsense probably null
R0112:Igsf10 UTSW 3 59,233,429 (GRCm39) missense probably benign 0.00
R0141:Igsf10 UTSW 3 59,238,253 (GRCm39) missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59,227,527 (GRCm39) missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59,236,089 (GRCm39) missense probably benign 0.01
R0556:Igsf10 UTSW 3 59,236,296 (GRCm39) missense probably benign 0.02
R0582:Igsf10 UTSW 3 59,227,188 (GRCm39) missense probably benign 0.00
R0630:Igsf10 UTSW 3 59,233,483 (GRCm39) missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59,236,015 (GRCm39) missense probably benign 0.14
R0948:Igsf10 UTSW 3 59,238,525 (GRCm39) missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59,239,269 (GRCm39) missense probably benign 0.03
R1412:Igsf10 UTSW 3 59,235,196 (GRCm39) splice site probably benign
R1473:Igsf10 UTSW 3 59,226,188 (GRCm39) missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59,237,838 (GRCm39) missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59,233,583 (GRCm39) missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59,238,706 (GRCm39) missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59,235,921 (GRCm39) nonsense probably null
R1748:Igsf10 UTSW 3 59,226,514 (GRCm39) missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59,236,617 (GRCm39) missense probably benign 0.09
R1856:Igsf10 UTSW 3 59,238,693 (GRCm39) missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59,236,993 (GRCm39) missense probably benign 0.40
R2148:Igsf10 UTSW 3 59,243,998 (GRCm39) missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59,239,101 (GRCm39) missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59,239,287 (GRCm39) missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59,239,287 (GRCm39) missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59,232,875 (GRCm39) missense probably benign 0.14
R2913:Igsf10 UTSW 3 59,239,157 (GRCm39) missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59,236,848 (GRCm39) missense probably benign
R3547:Igsf10 UTSW 3 59,243,935 (GRCm39) missense probably damaging 1.00
R3547:Igsf10 UTSW 3 59,237,962 (GRCm39) missense probably benign 0.02
R3548:Igsf10 UTSW 3 59,243,935 (GRCm39) missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59,243,752 (GRCm39) missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59,233,135 (GRCm39) missense probably benign 0.29
R3743:Igsf10 UTSW 3 59,233,546 (GRCm39) missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59,239,345 (GRCm39) missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59,235,981 (GRCm39) missense probably benign 0.00
R4184:Igsf10 UTSW 3 59,227,152 (GRCm39) missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59,226,171 (GRCm39) missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59,236,972 (GRCm39) missense probably benign 0.04
R4575:Igsf10 UTSW 3 59,237,521 (GRCm39) missense probably benign
R4676:Igsf10 UTSW 3 59,233,370 (GRCm39) missense probably benign 0.23
R4700:Igsf10 UTSW 3 59,227,751 (GRCm39) missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59,237,126 (GRCm39) missense probably benign 0.01
R4986:Igsf10 UTSW 3 59,236,027 (GRCm39) missense probably benign 0.24
R5012:Igsf10 UTSW 3 59,226,143 (GRCm39) missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59,235,714 (GRCm39) missense probably benign 0.02
R5083:Igsf10 UTSW 3 59,233,694 (GRCm39) missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59,227,553 (GRCm39) missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59,233,175 (GRCm39) missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59,235,574 (GRCm39) missense probably benign 0.01
R5810:Igsf10 UTSW 3 59,226,492 (GRCm39) missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59,237,832 (GRCm39) missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59,238,252 (GRCm39) missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59,235,578 (GRCm39) missense probably benign 0.12
R6145:Igsf10 UTSW 3 59,239,077 (GRCm39) missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59,226,336 (GRCm39) missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59,232,931 (GRCm39) missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59,235,928 (GRCm39) missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59,226,870 (GRCm39) missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59,237,760 (GRCm39) missense probably benign 0.00
R6490:Igsf10 UTSW 3 59,236,992 (GRCm39) missense probably benign 0.06
R6785:Igsf10 UTSW 3 59,226,665 (GRCm39) missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59,235,865 (GRCm39) missense probably benign
R6889:Igsf10 UTSW 3 59,239,354 (GRCm39) missense probably benign
R7024:Igsf10 UTSW 3 59,239,122 (GRCm39) missense probably benign 0.00
R7056:Igsf10 UTSW 3 59,238,501 (GRCm39) missense probably damaging 1.00
R7128:Igsf10 UTSW 3 59,236,326 (GRCm39) missense probably benign
R7251:Igsf10 UTSW 3 59,226,875 (GRCm39) missense probably damaging 1.00
R7313:Igsf10 UTSW 3 59,236,837 (GRCm39) missense probably benign 0.05
R7340:Igsf10 UTSW 3 59,233,189 (GRCm39) missense probably damaging 1.00
R7447:Igsf10 UTSW 3 59,239,222 (GRCm39) missense probably benign 0.39
R7506:Igsf10 UTSW 3 59,226,775 (GRCm39) missense probably damaging 1.00
R7678:Igsf10 UTSW 3 59,226,761 (GRCm39) missense possibly damaging 0.81
R7695:Igsf10 UTSW 3 59,233,612 (GRCm39) missense probably damaging 1.00
R7709:Igsf10 UTSW 3 59,238,964 (GRCm39) missense probably damaging 0.96
R7749:Igsf10 UTSW 3 59,236,549 (GRCm39) missense possibly damaging 0.88
R7808:Igsf10 UTSW 3 59,235,489 (GRCm39) missense probably benign 0.00
R7850:Igsf10 UTSW 3 59,227,053 (GRCm39) missense probably benign 0.33
R7879:Igsf10 UTSW 3 59,238,145 (GRCm39) missense probably damaging 1.00
R7886:Igsf10 UTSW 3 59,235,748 (GRCm39) missense probably benign 0.01
R7891:Igsf10 UTSW 3 59,235,832 (GRCm39) nonsense probably null
R7946:Igsf10 UTSW 3 59,227,125 (GRCm39) missense possibly damaging 0.69
R7948:Igsf10 UTSW 3 59,239,279 (GRCm39) missense probably benign 0.02
R8004:Igsf10 UTSW 3 59,237,130 (GRCm39) missense probably benign 0.01
R8096:Igsf10 UTSW 3 59,236,380 (GRCm39) missense probably damaging 0.98
R8141:Igsf10 UTSW 3 59,237,949 (GRCm39) missense probably damaging 0.96
R8183:Igsf10 UTSW 3 59,238,036 (GRCm39) missense probably benign 0.04
R8203:Igsf10 UTSW 3 59,236,254 (GRCm39) missense probably benign 0.11
R8325:Igsf10 UTSW 3 59,225,954 (GRCm39) missense probably damaging 0.96
R8350:Igsf10 UTSW 3 59,238,949 (GRCm39) missense probably damaging 1.00
R8387:Igsf10 UTSW 3 59,236,564 (GRCm39) missense probably damaging 1.00
R8488:Igsf10 UTSW 3 59,227,431 (GRCm39) missense probably damaging 1.00
R8697:Igsf10 UTSW 3 59,226,308 (GRCm39) missense probably benign 0.02
R8786:Igsf10 UTSW 3 59,238,063 (GRCm39) missense probably benign 0.25
R8804:Igsf10 UTSW 3 59,243,876 (GRCm39) missense probably damaging 1.00
R8886:Igsf10 UTSW 3 59,237,410 (GRCm39) missense probably benign 0.00
R8902:Igsf10 UTSW 3 59,243,633 (GRCm39) missense probably benign 0.00
R8906:Igsf10 UTSW 3 59,233,739 (GRCm39) missense probably benign 0.01
R8917:Igsf10 UTSW 3 59,226,888 (GRCm39) missense possibly damaging 0.69
R9051:Igsf10 UTSW 3 59,236,668 (GRCm39) missense probably benign 0.00
R9178:Igsf10 UTSW 3 59,233,480 (GRCm39) missense possibly damaging 0.69
R9228:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9230:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9231:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9232:Igsf10 UTSW 3 59,243,843 (GRCm39) missense probably damaging 1.00
R9417:Igsf10 UTSW 3 59,236,526 (GRCm39) missense possibly damaging 0.94
R9609:Igsf10 UTSW 3 59,226,869 (GRCm39) missense probably damaging 1.00
R9631:Igsf10 UTSW 3 59,237,904 (GRCm39) missense probably damaging 1.00
R9689:Igsf10 UTSW 3 59,233,624 (GRCm39) missense probably damaging 1.00
R9762:Igsf10 UTSW 3 59,237,106 (GRCm39) missense probably damaging 1.00
R9770:Igsf10 UTSW 3 59,227,199 (GRCm39) missense probably benign 0.07
R9798:Igsf10 UTSW 3 59,239,126 (GRCm39) missense probably damaging 1.00
Z1088:Igsf10 UTSW 3 59,237,359 (GRCm39) missense possibly damaging 0.59
Z1177:Igsf10 UTSW 3 59,237,026 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGACCATTTCTTTTGGGAG -3'
(R):5'- GAGTTGGAGTTAAGGTCCCATAG -3'

Sequencing Primer
(F):5'- ACCATTTCTTTTGGGAGGGAGGTC -3'
(R):5'- GGAGTTAAGGTCCCATAGGATTAATC -3'
Posted On 2017-06-26