Incidental Mutation 'R5979:Synpo2'
ID 481297
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Name synaptopodin 2
Synonyms 1110069I04Rik, 2310068J10Rik, 9530006G20Rik, myopodin, Myo
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 122870168-123029798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122911060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 195 (L195P)
Ref Sequence ENSEMBL: ENSMUSP00000142508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051443] [ENSMUST00000106426] [ENSMUST00000106427] [ENSMUST00000184590] [ENSMUST00000198584]
AlphaFold Q91YE8
Predicted Effect probably benign
Transcript: ENSMUST00000051443
SMART Domains Protein: ENSMUSP00000051570
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106426
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: L195P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106427
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: L195P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139160
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184590
SMART Domains Protein: ENSMUSP00000142426
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
low complexity region 141 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198584
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142508
Gene: ENSMUSG00000050315
AA Change: L195P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 122,906,859 (GRCm39) missense probably damaging 1.00
IGL00742:Synpo2 APN 3 122,907,525 (GRCm39) missense probably damaging 1.00
IGL01890:Synpo2 APN 3 122,906,146 (GRCm39) missense probably damaging 1.00
IGL02268:Synpo2 APN 3 122,910,632 (GRCm39) missense probably damaging 1.00
IGL02323:Synpo2 APN 3 122,911,183 (GRCm39) missense probably benign 0.00
IGL02745:Synpo2 APN 3 122,907,261 (GRCm39) missense probably damaging 1.00
IGL03001:Synpo2 APN 3 122,873,604 (GRCm39) missense probably benign 0.00
IGL03177:Synpo2 APN 3 122,914,864 (GRCm39) missense probably damaging 1.00
IGL03336:Synpo2 APN 3 122,907,828 (GRCm39) missense possibly damaging 0.60
R0086:Synpo2 UTSW 3 122,910,753 (GRCm39) nonsense probably null
R0126:Synpo2 UTSW 3 122,873,511 (GRCm39) missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 122,907,442 (GRCm39) missense probably benign 0.02
R0284:Synpo2 UTSW 3 122,873,383 (GRCm39) nonsense probably null
R0388:Synpo2 UTSW 3 122,873,546 (GRCm39) missense probably benign
R0457:Synpo2 UTSW 3 122,906,421 (GRCm39) missense probably damaging 1.00
R0483:Synpo2 UTSW 3 122,907,981 (GRCm39) missense probably damaging 1.00
R0615:Synpo2 UTSW 3 122,910,936 (GRCm39) missense probably damaging 1.00
R0646:Synpo2 UTSW 3 122,908,098 (GRCm39) missense probably damaging 1.00
R0666:Synpo2 UTSW 3 122,907,708 (GRCm39) missense probably damaging 0.98
R0743:Synpo2 UTSW 3 122,906,355 (GRCm39) missense probably benign 0.02
R0791:Synpo2 UTSW 3 122,906,835 (GRCm39) missense probably benign
R1531:Synpo2 UTSW 3 122,911,315 (GRCm39) missense probably benign 0.03
R1587:Synpo2 UTSW 3 122,908,047 (GRCm39) missense probably damaging 0.98
R1717:Synpo2 UTSW 3 122,906,203 (GRCm39) missense probably damaging 1.00
R1807:Synpo2 UTSW 3 122,873,906 (GRCm39) missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 122,873,537 (GRCm39) missense probably benign 0.01
R2987:Synpo2 UTSW 3 122,910,622 (GRCm39) missense probably damaging 1.00
R3019:Synpo2 UTSW 3 122,907,228 (GRCm39) missense probably damaging 1.00
R3939:Synpo2 UTSW 3 122,908,239 (GRCm39) missense probably damaging 1.00
R4050:Synpo2 UTSW 3 122,907,927 (GRCm39) missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 122,910,799 (GRCm39) missense probably damaging 1.00
R4669:Synpo2 UTSW 3 122,906,712 (GRCm39) missense probably damaging 1.00
R4724:Synpo2 UTSW 3 122,907,940 (GRCm39) missense probably damaging 1.00
R4825:Synpo2 UTSW 3 122,908,068 (GRCm39) missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123,029,550 (GRCm39) critical splice donor site probably null
R5292:Synpo2 UTSW 3 122,907,709 (GRCm39) missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 122,911,331 (GRCm39) nonsense probably null
R5701:Synpo2 UTSW 3 122,873,879 (GRCm39) missense probably damaging 1.00
R5712:Synpo2 UTSW 3 122,914,859 (GRCm39) missense probably damaging 1.00
R5730:Synpo2 UTSW 3 122,907,768 (GRCm39) missense probably benign 0.04
R5879:Synpo2 UTSW 3 122,907,946 (GRCm39) missense probably damaging 1.00
R6290:Synpo2 UTSW 3 122,910,701 (GRCm39) missense probably damaging 0.98
R6384:Synpo2 UTSW 3 122,906,698 (GRCm39) nonsense probably null
R6498:Synpo2 UTSW 3 122,873,881 (GRCm39) splice site probably null
R7123:Synpo2 UTSW 3 122,906,835 (GRCm39) missense probably benign
R7153:Synpo2 UTSW 3 122,906,053 (GRCm39) makesense probably null
R7233:Synpo2 UTSW 3 122,911,333 (GRCm39) missense probably benign 0.01
R7301:Synpo2 UTSW 3 122,907,702 (GRCm39) missense probably benign 0.10
R7318:Synpo2 UTSW 3 122,910,968 (GRCm39) missense probably benign
R7366:Synpo2 UTSW 3 122,907,690 (GRCm39) missense probably damaging 0.96
R7630:Synpo2 UTSW 3 122,873,681 (GRCm39) missense probably damaging 1.00
R7962:Synpo2 UTSW 3 123,029,635 (GRCm39) missense probably benign 0.09
R8068:Synpo2 UTSW 3 122,911,041 (GRCm39) missense possibly damaging 0.59
R8335:Synpo2 UTSW 3 122,908,183 (GRCm39) missense probably damaging 1.00
R9066:Synpo2 UTSW 3 122,911,133 (GRCm39) missense possibly damaging 0.66
R9269:Synpo2 UTSW 3 122,910,973 (GRCm39) missense probably benign 0.00
R9318:Synpo2 UTSW 3 122,873,705 (GRCm39) missense probably damaging 1.00
R9623:Synpo2 UTSW 3 122,908,047 (GRCm39) missense possibly damaging 0.68
R9685:Synpo2 UTSW 3 122,911,366 (GRCm39) missense probably damaging 1.00
Z1177:Synpo2 UTSW 3 122,906,659 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGTCAGAGAAGTGTCTG -3'
(R):5'- ACCCTGCAGATTCAGCAAGC -3'

Sequencing Primer
(F):5'- ACGTCAGAGAAGTGTCTGCTTTCTC -3'
(R):5'- AGAGCGAAGACTTCTTTCTTGC -3'
Posted On 2017-06-26