Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Fbxl13'

481301

Institutional Source

Beutler Lab

Gene Symbol

Fbxl13

Ensembl Gene

ENSMUSG00000048520

Gene Name

F-box and leucine-rich repeat protein 13

Synonyms

4921539K22Rik

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5979 (G1)

Quality Score

218.009

Status

Validated

Chromosome

Chromosomal Location

21483847-21645634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21582091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 283 (I283F)

Ref Sequence

ENSEMBL: ENSMUSP00000110889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051358] [ENSMUST00000115234]

AlphaFold

Q8CDU4

Predicted Effect

probably damaging
Transcript: ENSMUST00000051358
AA Change: I283F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: I283F

Domain	Start	End	E-Value	Type
low complexity region	160	173	N/A	INTRINSIC
FBOX	243	283	3.73e-4	SMART
LRR_CC	328	353	6.62e-6	SMART
LRR	354	378	3.67e2	SMART
LRR	379	404	2.75e-3	SMART
LRR	407	425	4.51e2	SMART
LRR	426	451	2.63e0	SMART
LRR	476	501	4.15e1	SMART
LRR	502	526	1.82e1	SMART
LRR	529	554	1.76e-1	SMART
LRR_CC	555	580	4.61e-5	SMART
LRR	604	629	8.81e-2	SMART
LRR	630	655	2.37e1	SMART
LRR	656	681	3.21e-4	SMART
LRR	682	707	6.57e-1	SMART
LRR	708	733	9.47e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115234
AA Change: I283F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520
AA Change: I283F

Domain	Start	End	E-Value	Type
low complexity region	160	173	N/A	INTRINSIC
FBOX	243	283	3.73e-4	SMART
LRR_CC	328	353	6.62e-6	SMART
LRR	354	378	3.67e2	SMART
LRR	379	404	2.75e-3	SMART
LRR	407	432	6.88e-4	SMART
Blast:LRR	433	458	7e-8	BLAST
LRR	459	484	2.63e0	SMART
LRR	509	534	4.15e1	SMART
LRR	535	559	1.82e1	SMART
LRR	562	587	1.76e-1	SMART
LRR_CC	588	613	4.61e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137788

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153598

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Fbxl13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01722:Fbxl13	APN	5	21490414	missense	possibly damaging	0.81
IGL02178:Fbxl13	APN	5	21620720	missense	possibly damaging	0.56
IGL02271:Fbxl13	APN	5	21490456	missense	probably damaging	1.00
IGL02317:Fbxl13	APN	5	21522234	missense	probably benign	0.28
IGL02508:Fbxl13	APN	5	21556805	critical splice donor site	probably null
IGL02891:Fbxl13	APN	5	21522100	splice site	probably benign
IGL03387:Fbxl13	APN	5	21523798	critical splice donor site	probably null
Laurel	UTSW	5	21582053	nonsense	probably null
PIT4305001:Fbxl13	UTSW	5	21522148	missense	probably benign
R0040:Fbxl13	UTSW	5	21486373	missense	probably damaging	1.00
R0040:Fbxl13	UTSW	5	21486373	missense	probably damaging	1.00
R0278:Fbxl13	UTSW	5	21523910	missense	probably benign	0.03
R0597:Fbxl13	UTSW	5	21614714	missense	probably benign	0.09
R1110:Fbxl13	UTSW	5	21484036	missense	probably benign
R1172:Fbxl13	UTSW	5	21620604	splice site	probably benign
R1175:Fbxl13	UTSW	5	21620604	splice site	probably benign
R1464:Fbxl13	UTSW	5	21483991	missense	probably benign	0.21
R1464:Fbxl13	UTSW	5	21483991	missense	probably benign	0.21
R2174:Fbxl13	UTSW	5	21582048	missense	possibly damaging	0.74
R2426:Fbxl13	UTSW	5	21522137	missense	probably damaging	1.00
R4171:Fbxl13	UTSW	5	21543788	missense	probably benign	0.02
R4413:Fbxl13	UTSW	5	21582053	nonsense	probably null
R4655:Fbxl13	UTSW	5	21582039	missense	probably damaging	1.00
R4816:Fbxl13	UTSW	5	21484003	missense	probably benign	0.25
R5544:Fbxl13	UTSW	5	21524491	missense	probably damaging	0.96
R6176:Fbxl13	UTSW	5	21500500	missense	possibly damaging	0.83
R6211:Fbxl13	UTSW	5	21484021	missense	possibly damaging	0.57
R6252:Fbxl13	UTSW	5	21621501	missense	possibly damaging	0.96
R6336:Fbxl13	UTSW	5	21523547	critical splice donor site	probably null
R6455:Fbxl13	UTSW	5	21556814	missense	probably benign	0.02
R6522:Fbxl13	UTSW	5	21561556	splice site	probably null
R6827:Fbxl13	UTSW	5	21522178	missense	probably damaging	0.97
R6961:Fbxl13	UTSW	5	21543742	missense	probably damaging	1.00
R6998:Fbxl13	UTSW	5	21543689	missense	probably damaging	1.00
R6998:Fbxl13	UTSW	5	21620613	missense	probably null	0.03
R7152:Fbxl13	UTSW	5	21582067	missense	possibly damaging	0.95
R7196:Fbxl13	UTSW	5	21486303	missense	probably damaging	0.97
R7418:Fbxl13	UTSW	5	21581983	missense	probably benign	0.00
R7490:Fbxl13	UTSW	5	21523060	nonsense	probably null
R7649:Fbxl13	UTSW	5	21614666	missense	probably benign	0.13
R7816:Fbxl13	UTSW	5	21543787	missense	probably benign	0.11
R7954:Fbxl13	UTSW	5	21543769	missense	probably benign	0.19
R8036:Fbxl13	UTSW	5	21523568	missense	probably damaging	1.00
R8098:Fbxl13	UTSW	5	21620718	missense	probably benign	0.00
R8406:Fbxl13	UTSW	5	21523654	missense	probably damaging	1.00
R8912:Fbxl13	UTSW	5	21522186	missense	probably damaging	0.96
R9102:Fbxl13	UTSW	5	21632803	missense	probably benign	0.00
R9378:Fbxl13	UTSW	5	21585203	missense	probably damaging	0.98
R9473:Fbxl13	UTSW	5	21585245	missense	possibly damaging	0.67
R9553:Fbxl13	UTSW	5	21523153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTAGAGCATAGCTGGCAATAGTG -3'
(R):5'- AAGCGTGTGGGATTTGCATATC -3'

Sequencing Primer
(F):5'- CATAGCTGGCAATAGTGTGGATTG -3'
(R):5'- ATCAGTGCACTCTGCCATTATTAG -3'

Posted On

2017-06-26