Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Adamts3'

481302

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5979 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89861669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 45 (V45A)

Ref Sequence

ENSEMBL: ENSMUSP00000142771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: V45A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: V45A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: V45A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: V45A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196507

Predicted Effect

probably damaging
Transcript: ENSMUST00000198151
AA Change: V45A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: V45A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	174	2.3e-29	PFAM

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGGAGCTGTCTCATGCCATTC -3'
(R):5'- CCTAAGTGCATTTGAGAGATGC -3'

Sequencing Primer
(F):5'- CAGCCCCAGGAGCTATGAAGTG -3'
(R):5'- AAGTGCATTTGAGAGATGCTTTTAG -3'

Posted On

2017-06-26