Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Hepacam2'

481303

Institutional Source

Beutler Lab

Gene Symbol

Hepacam2

Ensembl Gene

ENSMUSG00000044156

Gene Name

HEPACAM family member 2

Synonyms

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R5979 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3457096-3498298 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3476149 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 183 (F183I)

Ref Sequence

ENSEMBL: ENSMUSP00000143834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049985] [ENSMUST00000201607]

AlphaFold

Q4VAH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000049985
AA Change: F259I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000058882
Gene: ENSMUSG00000044156
AA Change: F259I

Domain	Start	End	E-Value	Type
IG	39	142	7.77e-1	SMART
IGc2	165	227	6.21e-9	SMART
IG	256	334	1.87e0	SMART
transmembrane domain	351	373	N/A	INTRINSIC
low complexity region	420	437	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201276

Predicted Effect

probably damaging
Transcript: ENSMUST00000201607
AA Change: F183I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143834
Gene: ENSMUSG00000044156
AA Change: F183I

Domain	Start	End	E-Value	Type
IG_like	2	66	1.2e-1	SMART
IGc2	89	151	2.5e-11	SMART
Blast:IG	180	206	9e-11	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the immunoglobulin superfamily that plays a role in mitosis. Knockdown of this gene results in prometaphase arrest, abnormal nuclear morphology and apoptosis. Poly(ADP-ribosylation) of the encoded protein promotes its translocation to centrosomes, which may stimulate centrosome maturation. A chromosomal deletion including this gene may be associated with myeloid leukemia and myelodysplastic syndrome in human patients. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Hepacam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01937:Hepacam2	APN	6	3487117	missense	probably benign	0.07
IGL01945:Hepacam2	APN	6	3487117	missense	probably benign	0.07
IGL02254:Hepacam2	APN	6	3483421	missense	probably benign	0.06
IGL02445:Hepacam2	APN	6	3483481	missense	probably damaging	1.00
IGL02546:Hepacam2	APN	6	3483568	missense	possibly damaging	0.93
IGL02620:Hepacam2	APN	6	3487280	splice site	probably benign
IGL02697:Hepacam2	APN	6	3476036	missense	possibly damaging	0.79
R0089:Hepacam2	UTSW	6	3487094	missense	probably damaging	0.96
R0208:Hepacam2	UTSW	6	3467505	splice site	probably benign
R0230:Hepacam2	UTSW	6	3463336	missense	probably benign	0.01
R0299:Hepacam2	UTSW	6	3476121	missense	probably damaging	1.00
R0499:Hepacam2	UTSW	6	3476121	missense	probably damaging	1.00
R0608:Hepacam2	UTSW	6	3483479	missense	possibly damaging	0.93
R1350:Hepacam2	UTSW	6	3467530	nonsense	probably null
R1663:Hepacam2	UTSW	6	3483439	missense	possibly damaging	0.76
R1749:Hepacam2	UTSW	6	3483379	missense	probably damaging	1.00
R1997:Hepacam2	UTSW	6	3487241	missense	probably damaging	1.00
R2146:Hepacam2	UTSW	6	3463378	splice site	probably benign
R3911:Hepacam2	UTSW	6	3494477	start codon destroyed	probably null	0.98
R4281:Hepacam2	UTSW	6	3475938	missense	probably damaging	0.98
R4290:Hepacam2	UTSW	6	3487237	missense	probably benign	0.01
R4371:Hepacam2	UTSW	6	3486988	missense	probably damaging	1.00
R4794:Hepacam2	UTSW	6	3475933	missense	probably damaging	0.96
R4890:Hepacam2	UTSW	6	3487231	missense	probably damaging	0.96
R5330:Hepacam2	UTSW	6	3483377	missense	probably benign	0.00
R5331:Hepacam2	UTSW	6	3483377	missense	probably benign	0.00
R5677:Hepacam2	UTSW	6	3466142	missense	probably damaging	1.00
R5796:Hepacam2	UTSW	6	3466200	splice site	probably null
R5844:Hepacam2	UTSW	6	3476073	missense	probably damaging	0.99
R6017:Hepacam2	UTSW	6	3483332	missense	probably damaging	1.00
R7460:Hepacam2	UTSW	6	3487199	missense	probably benign	0.20
R8458:Hepacam2	UTSW	6	3483358	missense	probably damaging	1.00
R8928:Hepacam2	UTSW	6	3467623	critical splice donor site	probably null
R9525:Hepacam2	UTSW	6	3476046	missense	probably benign	0.33
R9762:Hepacam2	UTSW	6	3486940	missense	probably damaging	1.00
Z1177:Hepacam2	UTSW	6	3483352	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GTTGTAAGCACAGCACACATAG -3'
(R):5'- TGGGGCTTTAAATGAGGACC -3'

Sequencing Primer
(F):5'- ACACATAGTCAGCTGTCTTCTGGG -3'
(R):5'- GGCTTTAAATGAGGACCTATTTGCTC -3'

Posted On

2017-06-26