Incidental Mutation 'R5979:Sspo'
ID 481305
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene Name SCO-spondin
Synonyms Scospondin, C79529
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5979 (G1)
Quality Score 203.009
Status Validated
Chromosome 6
Chromosomal Location 48448229-48501250 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48463693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1747 (T1747I)
Ref Sequence ENSEMBL: ENSMUSP00000131401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043676
AA Change: T1622I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: T1622I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169350
AA Change: T1747I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: T1747I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212740
AA Change: T1747I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48470453 missense probably benign 0.02
IGL00339:Sspo APN 6 48483746 splice site probably benign
IGL00391:Sspo APN 6 48497386 missense probably damaging 0.96
IGL00433:Sspo APN 6 48490036 missense probably damaging 1.00
IGL00471:Sspo APN 6 48498213 splice site probably benign
IGL00500:Sspo APN 6 48497421 nonsense probably null
IGL00537:Sspo APN 6 48498213 splice site probably benign
IGL00540:Sspo APN 6 48498213 splice site probably benign
IGL01060:Sspo APN 6 48449479 nonsense probably null
IGL01090:Sspo APN 6 48490125 missense probably benign 0.08
IGL01125:Sspo APN 6 48492888 missense probably damaging 1.00
IGL01447:Sspo APN 6 48464666 splice site probably null
IGL01457:Sspo APN 6 48498343 missense probably benign 0.00
IGL01481:Sspo APN 6 48448515 missense probably benign 0.41
IGL01485:Sspo APN 6 48478731 missense probably damaging 1.00
IGL01544:Sspo APN 6 48491019 missense probably damaging 0.99
IGL01575:Sspo APN 6 48459042 missense probably benign 0.01
IGL01589:Sspo APN 6 48451178 missense probably damaging 1.00
IGL01601:Sspo APN 6 48486379 missense probably benign 0.33
IGL01644:Sspo APN 6 48452502 missense probably benign
IGL01659:Sspo APN 6 48474443 missense probably damaging 1.00
IGL01801:Sspo APN 6 48457138 missense probably damaging 1.00
IGL01872:Sspo APN 6 48454689 missense probably damaging 0.99
IGL01874:Sspo APN 6 48452190 missense probably damaging 1.00
IGL01936:Sspo APN 6 48475887 missense probably damaging 1.00
IGL01941:Sspo APN 6 48495182 missense probably benign 0.19
IGL01986:Sspo APN 6 48483303 missense probably benign 0.05
IGL01987:Sspo APN 6 48477624 splice site probably null
IGL02170:Sspo APN 6 48467983 missense possibly damaging 0.76
IGL02192:Sspo APN 6 48459568 missense possibly damaging 0.86
IGL02210:Sspo APN 6 48500492 missense probably damaging 1.00
IGL02225:Sspo APN 6 48484334 missense probably benign 0.09
IGL02280:Sspo APN 6 48496231 missense probably damaging 1.00
IGL02303:Sspo APN 6 48484705 missense possibly damaging 0.52
IGL02397:Sspo APN 6 48461638 missense probably benign 0.35
IGL02451:Sspo APN 6 48460303 splice site probably benign
IGL02500:Sspo APN 6 48478379 nonsense probably null
IGL02519:Sspo APN 6 48484828 missense probably damaging 1.00
IGL02549:Sspo APN 6 48451773 missense possibly damaging 0.81
IGL02562:Sspo APN 6 48490122 splice site probably null
IGL02673:Sspo APN 6 48475860 missense probably damaging 1.00
IGL02673:Sspo APN 6 48498775 critical splice donor site probably null
IGL02719:Sspo APN 6 48482667 missense probably benign 0.39
IGL02793:Sspo APN 6 48487894 splice site probably benign
IGL03003:Sspo APN 6 48455087 missense probably damaging 0.98
IGL03056:Sspo APN 6 48470538 missense probably benign 0.17
IGL03105:Sspo APN 6 48473658 splice site probably benign
IGL03116:Sspo APN 6 48494101 missense probably benign 0.32
IGL03163:Sspo APN 6 48484332 missense probably benign 0.19
IGL03198:Sspo APN 6 48477582 missense probably benign 0.31
IGL03365:Sspo APN 6 48459415 missense possibly damaging 0.82
Barrier UTSW 6 48495212 missense possibly damaging 0.58
R0312_sspo_280 UTSW 6 48455401 missense possibly damaging 0.52
R3112_Sspo_731 UTSW 6 48457600 missense probably damaging 1.00
R3498_Sspo_650 UTSW 6 48467980 missense possibly damaging 0.58
R4180_Sspo_324 UTSW 6 48498395 critical splice donor site probably null
spotsylvania UTSW 6 48476571 nonsense probably null
ANU74:Sspo UTSW 6 48460959 missense probably damaging 1.00
IGL02984:Sspo UTSW 6 48495155 missense probably benign 0.33
IGL03052:Sspo UTSW 6 48460453 missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48451065 missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48481239 missense probably benign
R0087:Sspo UTSW 6 48477785 missense probably damaging 1.00
R0122:Sspo UTSW 6 48473976 missense possibly damaging 0.95
R0129:Sspo UTSW 6 48455418 missense probably benign 0.00
R0164:Sspo UTSW 6 48494194 splice site probably benign
R0195:Sspo UTSW 6 48486636 missense probably benign
R0200:Sspo UTSW 6 48486415 missense probably null 0.01
R0201:Sspo UTSW 6 48455752 missense possibly damaging 0.64
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0243:Sspo UTSW 6 48493186 missense probably damaging 1.00
R0268:Sspo UTSW 6 48465555 missense probably benign 0.26
R0312:Sspo UTSW 6 48455401 missense possibly damaging 0.52
R0449:Sspo UTSW 6 48466740 missense probably damaging 1.00
R0523:Sspo UTSW 6 48451860 missense probably benign 0.20
R0576:Sspo UTSW 6 48464942 splice site probably null
R0671:Sspo UTSW 6 48490391 splice site probably benign
R0828:Sspo UTSW 6 48498734 missense probably damaging 1.00
R0880:Sspo UTSW 6 48475935 missense possibly damaging 0.69
R0903:Sspo UTSW 6 48455308 critical splice acceptor site probably null
R1051:Sspo UTSW 6 48491455 nonsense probably null
R1083:Sspo UTSW 6 48470999 missense possibly damaging 0.91
R1109:Sspo UTSW 6 48497443 missense probably damaging 1.00
R1118:Sspo UTSW 6 48459418 missense probably damaging 0.97
R1256:Sspo UTSW 6 48457639 missense probably damaging 1.00
R1342:Sspo UTSW 6 48461635 missense probably benign 0.07
R1355:Sspo UTSW 6 48448626 missense probably benign 0.41
R1370:Sspo UTSW 6 48448626 missense probably benign 0.41
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1476:Sspo UTSW 6 48463400 critical splice donor site probably null
R1566:Sspo UTSW 6 48466870 critical splice donor site probably null
R1630:Sspo UTSW 6 48457724 missense probably benign 0.01
R1686:Sspo UTSW 6 48460400 missense probably benign 0.00
R1707:Sspo UTSW 6 48477877 missense probably damaging 0.99
R1727:Sspo UTSW 6 48494848 missense probably damaging 1.00
R1822:Sspo UTSW 6 48492886 missense possibly damaging 0.75
R1831:Sspo UTSW 6 48489786 missense probably damaging 1.00
R1835:Sspo UTSW 6 48457340 missense probably damaging 0.97
R1862:Sspo UTSW 6 48491006 missense probably damaging 0.98
R1878:Sspo UTSW 6 48459366 missense possibly damaging 0.92
R1900:Sspo UTSW 6 48459350 missense probably benign 0.22
R1945:Sspo UTSW 6 48489773 missense possibly damaging 0.93
R1957:Sspo UTSW 6 48478273 missense probably damaging 0.99
R1990:Sspo UTSW 6 48451050 missense probably benign 0.00
R1996:Sspo UTSW 6 48475490 missense possibly damaging 0.50
R2049:Sspo UTSW 6 48460763 splice site probably benign
R2049:Sspo UTSW 6 48463531 missense probably benign 0.36
R2064:Sspo UTSW 6 48473662 missense probably damaging 0.99
R2072:Sspo UTSW 6 48473517 missense probably benign 0.01
R2096:Sspo UTSW 6 48461674 missense probably benign
R2106:Sspo UTSW 6 48466316 missense possibly damaging 0.96
R2230:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2230:Sspo UTSW 6 48500503 missense probably benign 0.11
R2232:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2351:Sspo UTSW 6 48464869 missense probably damaging 1.00
R2423:Sspo UTSW 6 48454055 missense probably benign 0.00
R2508:Sspo UTSW 6 48464364 missense probably damaging 1.00
R3110:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3112:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3413:Sspo UTSW 6 48480697 missense probably damaging 1.00
R3433:Sspo UTSW 6 48475951 splice site probably null
R3498:Sspo UTSW 6 48467980 missense possibly damaging 0.58
R3732:Sspo UTSW 6 48449930 missense probably damaging 1.00
R3816:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3818:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3819:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3838:Sspo UTSW 6 48480820 missense probably damaging 1.00
R3850:Sspo UTSW 6 48492490 missense probably damaging 1.00
R3880:Sspo UTSW 6 48494940 missense probably benign 0.38
R3893:Sspo UTSW 6 48476571 nonsense probably null
R4116:Sspo UTSW 6 48456994 missense probably damaging 0.99
R4179:Sspo UTSW 6 48498395 critical splice donor site probably null
R4180:Sspo UTSW 6 48498395 critical splice donor site probably null
R4207:Sspo UTSW 6 48478293 missense probably benign 0.00
R4210:Sspo UTSW 6 48464901 missense probably benign 0.00
R4223:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4224:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4225:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4229:Sspo UTSW 6 48490934 missense probably benign 0.00
R4230:Sspo UTSW 6 48490934 missense probably benign 0.00
R4363:Sspo UTSW 6 48498731 missense probably damaging 1.00
R4370:Sspo UTSW 6 48466348 missense probably null 0.14
R4407:Sspo UTSW 6 48460520 missense probably damaging 1.00
R4438:Sspo UTSW 6 48487353 missense probably damaging 1.00
R4454:Sspo UTSW 6 48487225 missense probably benign 0.05
R4455:Sspo UTSW 6 48465516 missense probably damaging 1.00
R4561:Sspo UTSW 6 48475534 splice site probably null
R4574:Sspo UTSW 6 48465523 missense probably damaging 1.00
R4578:Sspo UTSW 6 48463373 missense possibly damaging 0.58
R4653:Sspo UTSW 6 48478646 missense probably damaging 1.00
R4656:Sspo UTSW 6 48454076 missense possibly damaging 0.65
R4659:Sspo UTSW 6 48484213 missense probably damaging 1.00
R4664:Sspo UTSW 6 48473534 missense possibly damaging 0.82
R4685:Sspo UTSW 6 48492894 missense probably damaging 0.98
R4692:Sspo UTSW 6 48482687 missense probably damaging 1.00
R4703:Sspo UTSW 6 48500453 missense probably damaging 1.00
R4704:Sspo UTSW 6 48498704 missense probably damaging 1.00
R4738:Sspo UTSW 6 48478396 missense possibly damaging 0.78
R4766:Sspo UTSW 6 48470580 missense probably benign 0.04
R4771:Sspo UTSW 6 48460879 missense probably damaging 1.00
R4790:Sspo UTSW 6 48460771 missense probably benign 0.04
R4792:Sspo UTSW 6 48461585 missense probably benign 0.00
R4808:Sspo UTSW 6 48451161 missense probably damaging 1.00
R4812:Sspo UTSW 6 48490510 missense probably benign 0.00
R4883:Sspo UTSW 6 48460822 missense probably benign 0.00
R4906:Sspo UTSW 6 48465730 critical splice acceptor site probably null
R4934:Sspo UTSW 6 48465552 missense probably damaging 1.00
R4945:Sspo UTSW 6 48467087 splice site probably null
R4967:Sspo UTSW 6 48464605 missense probably damaging 0.97
R5016:Sspo UTSW 6 48452280 nonsense probably null
R5018:Sspo UTSW 6 48455700 missense probably damaging 1.00
R5034:Sspo UTSW 6 48480823 missense possibly damaging 0.93
R5044:Sspo UTSW 6 48466955 critical splice acceptor site probably null
R5055:Sspo UTSW 6 48464795 missense probably damaging 1.00
R5087:Sspo UTSW 6 48488471 missense possibly damaging 0.51
R5155:Sspo UTSW 6 48460474 missense probably benign 0.03
R5223:Sspo UTSW 6 48478324 missense probably damaging 1.00
R5249:Sspo UTSW 6 48493310 missense probably damaging 0.98
R5257:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5258:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5276:Sspo UTSW 6 48490467 missense probably damaging 1.00
R5307:Sspo UTSW 6 48454850 missense probably damaging 0.99
R5341:Sspo UTSW 6 48459615 missense probably damaging 1.00
R5361:Sspo UTSW 6 48466313 missense probably benign 0.02
R5385:Sspo UTSW 6 48462253 missense probably benign 0.18
R5394:Sspo UTSW 6 48495260 missense possibly damaging 0.52
R5477:Sspo UTSW 6 48498393 missense possibly damaging 0.60
R5490:Sspo UTSW 6 48493280 missense probably benign 0.33
R5512:Sspo UTSW 6 48455671 missense probably damaging 0.97
R5518:Sspo UTSW 6 48496654 missense possibly damaging 0.92
R5530:Sspo UTSW 6 48465583 missense probably damaging 0.97
R5538:Sspo UTSW 6 48452178 missense probably damaging 0.99
R5590:Sspo UTSW 6 48474491 missense probably damaging 1.00
R5613:Sspo UTSW 6 48455044 missense possibly damaging 0.79
R5638:Sspo UTSW 6 48492891 missense possibly damaging 0.86
R5809:Sspo UTSW 6 48460045 missense possibly damaging 0.59
R5810:Sspo UTSW 6 48483898 missense probably benign 0.02
R5814:Sspo UTSW 6 48451884 missense probably damaging 1.00
R5915:Sspo UTSW 6 48464596 missense probably benign 0.00
R5915:Sspo UTSW 6 48491484 missense possibly damaging 0.83
R5996:Sspo UTSW 6 48494176 missense possibly damaging 0.87
R6012:Sspo UTSW 6 48451371 missense probably benign 0.00
R6025:Sspo UTSW 6 48486786 missense possibly damaging 0.83
R6120:Sspo UTSW 6 48465576 missense probably damaging 1.00
R6150:Sspo UTSW 6 48486379 missense probably benign 0.33
R6221:Sspo UTSW 6 48463705 missense probably damaging 1.00
R6261:Sspo UTSW 6 48462191 missense possibly damaging 0.75
R6312:Sspo UTSW 6 48457366 critical splice donor site probably null
R6372:Sspo UTSW 6 48472541 missense probably damaging 1.00
R6456:Sspo UTSW 6 48451806 missense probably benign 0.08
R6497:Sspo UTSW 6 48495208 missense possibly damaging 0.71
R6501:Sspo UTSW 6 48495212 missense possibly damaging 0.58
R6617:Sspo UTSW 6 48491046 missense possibly damaging 0.93
R6825:Sspo UTSW 6 48465525 missense probably benign 0.04
R6831:Sspo UTSW 6 48484833 missense possibly damaging 0.68
R6861:Sspo UTSW 6 48487955 missense probably benign 0.15
R6961:Sspo UTSW 6 48463877 missense probably benign 0.05
R6967:Sspo UTSW 6 48489794 missense probably benign 0.21
R7016:Sspo UTSW 6 48449164 missense probably damaging 1.00
R7035:Sspo UTSW 6 48449213 splice site probably null
R7058:Sspo UTSW 6 48448582 missense probably damaging 1.00
R7072:Sspo UTSW 6 48454979 missense probably damaging 1.00
R7078:Sspo UTSW 6 48460379 missense probably damaging 1.00
R7082:Sspo UTSW 6 48478609 critical splice acceptor site probably null
R7120:Sspo UTSW 6 48465571 missense probably benign 0.05
R7127:Sspo UTSW 6 48449512 missense probably benign 0.02
R7146:Sspo UTSW 6 48501095 missense probably benign 0.15
R7220:Sspo UTSW 6 48476606 nonsense probably null
R7242:Sspo UTSW 6 48473952 missense probably benign
R7261:Sspo UTSW 6 48450077 missense possibly damaging 0.52
R7313:Sspo UTSW 6 48454828 missense probably damaging 1.00
R7313:Sspo UTSW 6 48473456 missense probably benign 0.04
R7323:Sspo UTSW 6 48461647 missense possibly damaging 0.93
R7330:Sspo UTSW 6 48475462 missense probably benign 0.00
R7351:Sspo UTSW 6 48464921 missense possibly damaging 0.89
R7467:Sspo UTSW 6 48486303 missense probably damaging 1.00
R7475:Sspo UTSW 6 48455860 missense probably benign 0.37
R7489:Sspo UTSW 6 48473713 missense probably damaging 0.99
R7508:Sspo UTSW 6 48466699 missense probably damaging 1.00
R7515:Sspo UTSW 6 48493886 missense probably damaging 1.00
R7564:Sspo UTSW 6 48449500 missense probably benign 0.04
R7607:Sspo UTSW 6 48489727 missense probably damaging 1.00
R7620:Sspo UTSW 6 48467086 critical splice donor site probably null
R7667:Sspo UTSW 6 48475371 nonsense probably null
R7691:Sspo UTSW 6 48484229 missense probably benign 0.12
R7707:Sspo UTSW 6 48461527 missense probably benign 0.01
R7723:Sspo UTSW 6 48464638 missense probably damaging 0.99
R7748:Sspo UTSW 6 48449465 nonsense probably null
R7767:Sspo UTSW 6 48451382 missense probably damaging 0.96
R7792:Sspo UTSW 6 48454690 missense probably damaging 0.98
R7878:Sspo UTSW 6 48492526 missense probably damaging 1.00
R7893:Sspo UTSW 6 48463310 missense probably benign 0.02
R7942:Sspo UTSW 6 48488500 splice site probably null
R7952:Sspo UTSW 6 48487329 missense probably damaging 1.00
R7981:Sspo UTSW 6 48468494 missense probably benign
R7995:Sspo UTSW 6 48492889 missense probably damaging 1.00
R8088:Sspo UTSW 6 48457613 missense probably damaging 1.00
R8129:Sspo UTSW 6 48467025 missense possibly damaging 0.79
R8145:Sspo UTSW 6 48467749 missense possibly damaging 0.49
R8202:Sspo UTSW 6 48457600 missense probably damaging 1.00
R8211:Sspo UTSW 6 48492609 critical splice donor site probably null
R8240:Sspo UTSW 6 48483502 missense possibly damaging 0.84
R8252:Sspo UTSW 6 48485452 missense probably damaging 0.99
R8270:Sspo UTSW 6 48449963 missense probably benign
R8272:Sspo UTSW 6 48448519 missense probably benign 0.03
R8316:Sspo UTSW 6 48482688 missense probably damaging 1.00
R8384:Sspo UTSW 6 48482664 missense probably damaging 1.00
R8390:Sspo UTSW 6 48467962 missense probably benign 0.00
R8770:Sspo UTSW 6 48474272 missense probably null 1.00
R8827:Sspo UTSW 6 48457672 missense possibly damaging 0.59
R8882:Sspo UTSW 6 48475456 missense probably damaging 1.00
R8886:Sspo UTSW 6 48481267 missense possibly damaging 0.92
R8946:Sspo UTSW 6 48457137 missense probably damaging 1.00
R8947:Sspo UTSW 6 48448570 missense probably damaging 1.00
R9028:Sspo UTSW 6 48496153 missense probably benign 0.38
R9043:Sspo UTSW 6 48493280 missense probably benign 0.07
R9056:Sspo UTSW 6 48473674 missense probably damaging 0.97
R9071:Sspo UTSW 6 48457048 missense probably benign 0.00
R9133:Sspo UTSW 6 48457813 missense possibly damaging 0.81
R9187:Sspo UTSW 6 48495289 missense probably damaging 1.00
R9205:Sspo UTSW 6 48455872 missense probably benign 0.03
R9213:Sspo UTSW 6 48463935 missense possibly damaging 0.91
R9214:Sspo UTSW 6 48463935 missense possibly damaging 0.91
R9215:Sspo UTSW 6 48463935 missense possibly damaging 0.91
R9235:Sspo UTSW 6 48489784 missense probably damaging 1.00
R9254:Sspo UTSW 6 48487994 missense probably damaging 1.00
R9291:Sspo UTSW 6 48496396 missense probably damaging 1.00
R9312:Sspo UTSW 6 48468462 missense probably benign 0.00
R9357:Sspo UTSW 6 48467055 missense possibly damaging 0.77
R9480:Sspo UTSW 6 48493886 missense probably damaging 1.00
R9586:Sspo UTSW 6 48481105 missense probably benign 0.03
R9660:Sspo UTSW 6 48455773 missense probably damaging 1.00
R9661:Sspo UTSW 6 48478338 nonsense probably null
R9728:Sspo UTSW 6 48455773 missense probably damaging 1.00
R9776:Sspo UTSW 6 48462335 missense probably benign 0.00
RF009:Sspo UTSW 6 48459985 nonsense probably null
X0060:Sspo UTSW 6 48466294 missense probably damaging 1.00
X0060:Sspo UTSW 6 48480794 missense probably damaging 1.00
X0063:Sspo UTSW 6 48497422 missense probably damaging 0.96
X0065:Sspo UTSW 6 48461684 missense probably benign 0.00
Z1176:Sspo UTSW 6 48481293 missense probably damaging 1.00
Z1177:Sspo UTSW 6 48457026 missense probably benign 0.31
Z1177:Sspo UTSW 6 48464816 missense possibly damaging 0.72
Z1177:Sspo UTSW 6 48470984 missense probably benign 0.16
Z1177:Sspo UTSW 6 48473435 missense probably damaging 0.99
Z1177:Sspo UTSW 6 48490548 nonsense probably null
Z1177:Sspo UTSW 6 48490890 missense probably damaging 1.00
Z1186:Sspo UTSW 6 48468507 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGACTGCTGCTTTCCCAG -3'
(R):5'- CATTCTCCATCCACTGCAAGG -3'

Sequencing Primer
(F):5'- ACCCAGACTGTGAATTGGC -3'
(R):5'- AGAGCCTCTATTGTCTCCTC -3'
Posted On 2017-06-26